BNL1672, BNL1672 (genetic_marker) Gossypium hirsutum

Marker Overview
NameBNL1672
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL1672_orig=BNL3031_orig
Source Typegenomic
Repeat Motif(AG)14
PCR ConditionAnnealing temperature: 55
Primer 1BNL1672_F: TGGATTTGTCCCTCTGTGTG
Primer 2BNL1672_R: AACCAACTTTTCCAACACCG
PolymorphismP_ BNL1672
CommentPrimer data obtained in 2000
Germplasm
Stock NameType
Deltapine 90obsolete_cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL1672_FBNL1672_FGossypium hirsutumprimer
BNL1672_RBNL1672_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber lengthqFL.HP-ch9Gossypium spp.QTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
seed cotton weight per bollqBWT.TSP-BNL1672Gossypium spp.QTL
micronaireqMIC.TSP-BNL1672Gossypium spp.QTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL1672BNL1672Gossypium hirsutummarker_locus
BNL1672bBNL1672bGossypium hirsutummarker_locus
BNL1672aBNL1672aGossypium hirsutummarker_locus
BNL1672-136BNL1672-136Gossypium hirsutummarker_locus
BNL1672-110BNL1672-110Gossypium hirsutummarker_locus
BNL1672-140BNL1672-140Gossypium hirsutummarker_locus
BNL1672-1BNL1672-1Gossypium hirsutummarker_locus
BNL1672-2BNL1672-2Gossypium hirsutummarker_locus
BNL1672_140BNL1672_140Gossypium hirsutummarker_locus
BNL1672aBNL1672a-49.424Gossypium hirsutummarker_locus
BNL1672bBNL1672b-51.99Gossypium hirsutummarker_locus
BNL1672bBNL1672b-71.1Gossypium hirsutummarker_locus
BNL1672aBNL1672a-84.3Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL1672_orig=BNL3031_origBNL1672_orig=BNL3031_origGossypium hirsutumsequence_feature


Sequence
>BNL1672 ID=BNL1672|Name=BNL1672|organism=Gossypium hirsutum|type=genetic_marker|length=136bp
TGGATTTGTCCCTCTGTGTGTATAAAGAGAGAGAGAGAGAGAGAGAGAGA
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGACTTTATTAGTAAAATTGTAA
TGATCCAATTTTCTGTCGGTGTTGGAAAAGTTGGTT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part.SSZ8-4WC_D09N/AAD_chr.2325.5BNL1672
27235 x TM-1, RIL (2007)7235 x TM-1, RIL (2007).7T-RIL_A09N/AAD_chr.090BNL1672
3Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c09N/AAD_chr.0950.56BNL1672
4AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr23N/AAD_chr.2399BNL1672
5AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr09N/AAD_chr.09130BNL1672
6Zhongmiansuo-12 x 8891, RIL (2007)Zhongmiansuo-12 x 8891, RIL (2007).Z8-RIL_ch23/D09N/AAD_chr.230BNL1672
7Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c23N/AAD_chr.2357.46BNL1672
87235 x TM-1, F2:3 (2005)7T-F2:3_chr09N/AAD_chr.096.8BNL1672
9CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr23N/ADt.0969.8BNL1672
10CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr09N/AAD_chr.09124.8BNL1672b
11Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr09N/AAD_chr.0971.84BNL1672b
12Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr09N/AAD_chr.09118BNL1672b
13Handan-208 x Pima-90, F2:3 (2007)Handan-208 x Pima-90, F2:3 (2007).HP-F2:3_chr23N/AAD_chr.2365.5BNL1672b
14Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr23N/AAD_chr.2390BNL1672b
15TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c23N/AAD_chr.2391.64BNL1672b
16TM-1 x 3-79, RIL (2014)T3-RIL.14_chr23N/AAD_chr.2352BNL1672b
17CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr23N/AAD_chr.23115.8BNL1672a
18Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr23N/AAD_chr.23117.7BNL1672a
19Handan-208 x Pima-90, F2:3 (2007)Handan-208 x Pima-90, F2:3 (2007).HP-F2:3_chr09N/AAD_chr.0951BNL1672a
20Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr09N/AAD_chr.0990BNL1672a
21TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c09N/AAD_chr.0991.51BNL1672a
22Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr23N/AAD_chr.2365.69BNL1672a
23TM-1 x 3-79, RIL (2014)T3-RIL.14_chr09N/AAD_chr.0949.4BNL1672a
24HS-46 x MARCABUCAG8US-1-88, RIL (2009)HS-46 x MARCABUCAG8US-1-88, RIL (2009).HSM-RIL_chr09N/AAD_chr.09144BNL1672-136
25TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr09N/AAD_chr.0959.7BNL1672-110
26TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr09/A9N/AAD_chr.0960.02BNL1672-110
27Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_chr09.3N/AAD_chr.0919.4BNL1672-110
28TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr23N/AAD_chr.2371.2BNL1672-140
29TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr23/D9N/AAD_chr.2370.92BNL1672-140
30Xinluzao-1 x Hai-7124, F2 (2008)Xinluzao-1 x Hai-7124, F2 (2008).XH-F2_lg12/chr23N/AAD_chr.2392.6BNL1672-1
31Xinluzao-1 x Hai-7124, F2 (2008)Xinluzao-1 x Hai-7124, F2 (2008).XH-F2_lg13/chr09N/AAD_chr.09133.7BNL1672-2
32TM-1 x Hai-7124, BC1S1 (2007)TH-BC1S1_chr23N/AAD_chr.2362.9BNL1672_140
33TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.09N/AAD_chr.0949.42BNL1672a
34TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.23N/AAD_chr.2351.99BNL1672b
35PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr09N/AAt.0971.1BNL1672b
36PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr23N/ADt.0984.3BNL1672a