BNL1454, BNL1454 (genetic_marker) Gossypium hirsutum

Marker Overview
NameBNL1454
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL1454_orig
Source Typegenomic
Repeat Motif(AG)14
PCR ConditionAnnealing temperature: 55
Primer 1BNL1454_F: AGGAAGGAGCGAAGGAAGAG
Primer 2BNL1454_R: CTTTCCCCTCCCTTTTCAAG
PolymorphismP_ BNL1454
CommentPrimer data obtained in 2000
Germplasm
Stock NameType
Deltapine 90obsolete_cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL1454_FBNL1454_FGossypium hirsutumprimer
BNL1454_RBNL1454_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber elongationqFEL.YCY7-4WC_chr15-2.bb08.1Gossypium hirsutumQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber elongationqFEL.CY-RIL_ch15.swu10Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL1454BNL1454Gossypium hirsutummarker_locus
BNL1454BNL1454-89.84Gossypium hirsutummarker_locus
BNL1454BNL1454-37.55Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL1454_origBNL1454_origGossypium hirsutumsequence_feature


Sequence
>BNL1454 ID=BNL1454|Name=BNL1454|organism=Gossypium hirsutum|type=genetic_marker|length=103bp
AGGAAGGAGCGAAGGAAGAGGCAGAGAGAGAGAGAGAGAGAGAGAGAGAG
AGCGGGAAAAATAACAGTTGAGGATAGGCTGCACTTGAAAAGGGAGGGGA
AAG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr15N/AAD_chr.1544BNL1454View
2CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr15N/AAD_chr.1556.4BNL1454View
3Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr15N/AAD_chr.1530BNL1454View
4TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c15N/AAD_chr.1582.34BNL1454View
5(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr15-2N/AAD_chr.1533.3BNL1454View
6TM-1 x 3-79, RIL (2014)T3-RIL.14_chr15N/AAD_chr.1537.6BNL1454View
7CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr15N/AAD_chr.1598BNL1454View
8Yumian-1 x 7235, RIL (2015)Y7-RIL_chr15N/AAD_chr.1594.1BNL1454View
9CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr15N/ADt.0189.84BNL1454View
10TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.15N/AAD_chr.1537.55BNL1454View