BNL1434, BNL1434 (genetic_marker) Gossypium hirsutum

Marker Overview
NameBNL1434
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL1434_orig
Source Typegenomic
Repeat Motif(AG)13
PCR ConditionAnnealing temperature: 55
Primer 1BNL1434_F: AAATTCAAGAATCAAAAAACAACA
Primer 2BNL1434_R: TTATGCCAAAGTATATGGAGTAACG
PolymorphismP_ BNL1434
CommentPrimer data obtained in 2000
Germplasm
Stock NameType
Deltapine 90obsolete_cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL1434_FBNL1434_FGossypium hirsutumprimer
BNL1434_RBNL1434_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber elongationqFEL.PA-F2_ch02-1.pop17-08Gossypium hirsutum x mustelinumQTL
fiber elongationqFEL.PA-F2_ch02-1.pop17-09Gossypium hirsutum x mustelinumQTL
fiber elongationqFEL.PA-F2_ch02-1.pop17-jointGossypium hirsutum x mustelinumQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
short fiber contentqSFC.PA-F2_ch02-1.pop17-08Gossypium hirsutum x mustelinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL1434BNL1434Gossypium hirsutummarker_locus
BNL1434bBNL1434bGossypium hirsutummarker_locus
BNL1434aBNL1434aGossypium hirsutummarker_locus
BNL1434-244BNL1434-244Gossypium hirsutummarker_locus
BNL1434-245BNL1434-245Gossypium hirsutummarker_locus
BNL1434/250y(C2)BNL1434/250y(C2)Gossypium hirsutummarker_locus
BNL1434(C2)BNL1434(C2)Gossypium hirsutummarker_locus
BNL1434BNL1434-96.434Gossypium hirsutummarker_locus
BNL1434BNL1434-47.1Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL1434_origBNL1434_origGossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D02chromosomeD02:4756717..4756977 -
A02chromosomeA02:3527855..3528102 -
CM018216.1chromosomeCM018216.1:4163068..4163324 -
CM018203.1chromosomeCM018203.1:3565238..3565501 -
D5_03chromosomeD5_03:59584022..59584279 +
Chr5chromosomeChr5:58114829..58115069 +
Chr03_CRI-A2_v1.0.a1chromosomeChr03_CRI-A2_v1.0.a1:3901667..3901907 -
Chr5chromosomeChr5:1266794..1267052 +
D10_03chromosomeD10_03:60928211..60928456 +
scaffold4267.1supercontigscaffold4267.1:32675..32920 +
scaffold189.1supercontigscaffold189.1:767259..767519 -
D02chromosomeD02:4720993..4721253 -
A02chromosomeA02:3419328..3419575 -
Ghir_D02chromosomeGhir_D02:4546479..4546739 -
Ghir_A02chromosomeGhir_A02:3566235..3566480 -
D02chromosomeD02:4345851..4346111 -
A02chromosomeA02:3417509..3417932 -
D02chromosomeD02:4565257..4565515 -
A02chromosomeA02:3681434..3681679 -
D02chromosomeD02:4486002..4486262 -
A02chromosomeA02:3556662..3556909 -
scaffold8917supercontigscaffold8917:106308..106562 +
scaffold8917supercontigscaffold8917:103359..103613 +
scaffold8917supercontigscaffold8917:112475..112731 +
scaffold10579supercontigscaffold10579:114049..114312 +
Gbar_D02chromosomeGbar_D02:4667176..4667432 -
Gbar_A02chromosomeGbar_A02:3491648..3491909 -
D02chromosomeD02:4302553..4302809 -
A02chromosomeA02:3488055..3488290 -
CM017624.1chromosomeCM017624.1:4938283..4938536 -
CM017611.1chromosomeCM017611.1:3565908..3566147 -
CM017650.1chromosomeCM017650.1:5203093..5203364 -
CM017637.1chromosomeCM017637.1:3614565..3614805 -
CM017702.1chromosomeCM017702.1:4594128..4594384 -
CM017689.1chromosomeCM017689.1:3558697..3558958 -
Chr05chromosomeBNL1434:1..362 .
Chr05:3928951..3929326 -
Sequence
>BNL1434 ID=BNL1434|Name=BNL1434|organism=Gossypium hirsutum|type=genetic_marker|length=246bp
AAATTCAAGAATCAAAAAACAACAAAACAAATTCATAAAAAAATAAAAGG
GAGAGAGAGAGAGAGAGAGAGAGAGAGAAATTGTTGGTTTAAAAACATGG
GGTCTAATAAAGATGGAGTTTTTCTTTTTTTCAGTTTCAATGTTTTTTGA
AAGGTTTAGTAGTGGTAGAGAGTGGNGAGTGGNGACTTGATTTGCTTTTA
TTTCTTTTATTCAAAATATGCCGTTACTCCATATACTTTGGCATAA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr02N/AAD_chr.0288.1BNL1434
2Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr02N/AAD_chr.0237.65BNL1434
3Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c02N/AAD_chr.0215.27BNL1434
4Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch02N/AAD_chr.0210.76BNL1434
5Handan-208 x Pima-90, F2:3 (2007)Handan-208 x Pima-90, F2:3 (2007).HP-F2:3_chr02N/AAD_chr.0216.3BNL1434
6AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr09N/AAD_chr.099BNL1434
7TM-1 x 3-79, RIL (2006)TM-1 x 3-79, RIL (2006).T3-RIL_chr.02N/AAD_chr.020BNL1434
8TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c02N/AAD_chr.0295.17BNL1434
9Yumian-1 x T586, F2:3 (2005)Yumian-1 x T586, F2:3 (2005).YT-F2:3_chr02N/AAD_chr.0221.7BNL1434
10AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr02N/AAD_chr.02167BNL1434
11Yumian-1 x T586, RIL (2006)YT-RIL_chr02-1N/AAD_chr.020BNL1434
12TM-1 x 3-79, RIL (2014)T3-RIL.14_chr02N/AAD_chr.0296.4BNL1434
13CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr02N/AAt.0249.3BNL1434
14Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr02N/AAD_chr.0215.5BNL1434b
15Guazuncho-2 x VH8-4602, BC2 (2005)Guazuncho-2 x VH8-4602, BC2 (2005).GV-BC2_chr09N/AAD_chr.0916.7BNL1434b
16Guazuncho-2 x VH8-4602, BC2 (2005)Guazuncho-2 x VH8-4602, BC2 (2005).GV-BC2_chr02N/AAD_chr.020BNL1434a
17Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr02N/AAD_chr.0290BNL1434a
18HS-46 x MARCABUCAG8US-1-88, RIL (2009)HS-46 x MARCABUCAG8US-1-88, RIL (2009).HSM-RIL_chr02N/AAD_chr.020BNL1434-244
19Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_chr02N/AAD_chr.028.3BNL1434-245
20Yumian-1 x T586, RIL (2009)YT-RIL_chr02-2N/AAD_chr.0234.9BNL1434/250y(C2)
21Yumian-1 x T586, F2:3 (2005.v0)YT-F2:3_chr02N/AAD_chr.0221.7BNL1434(C2)
22TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.02N/AAD_chr.0296.43BNL1434
23PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr02-1N/AAt.0247.1BNL1434