BNL1053, BNL1053 (genetic_marker) Gossypium hirsutum

Marker Overview
NameBNL1053
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL1053_orig
Source Typegenomic
Repeat Motif(AC)16
PCR ConditionAnnealing temperature: 55
Primer 1BNL1053_F: AGGGTCTGTCATGGTTGGAG
Primer 2BNL1053_R: CATGCATGCGTACGTGTGTA
PolymorphismP_ BNL1053
CommentPrimer data obtained in 2000
Germplasm
Stock NameType
Deltapine 90obsolete_cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL1053_FBNL1053_FGossypium hirsutumprimer
BNL1053_RBNL1053_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber strengthqFS.DJiM-RIL_ch01.hj08-13Gossypium hirsutumQTL
fiber strengthqFS.DJiM-RIL_ch15.hj08-13Gossypium hirsutumQTL
lint yieldqLY.DJiM-RIL_ch01.hj08-13.2Gossypium hirsutumQTL
lint yieldqLY.DJiM-RIL_ch15.hj08-13.2Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL1053BNL1053Gossypium hirsutummarker_locus
BNL1053bBNL1053bGossypium hirsutummarker_locus
BNL1053aBNL1053aGossypium hirsutummarker_locus
BNL1053-190BNL1053-190Gossypium hirsutummarker_locus
BNL1053/180y(C11)BNL1053/180y(C11)Gossypium hirsutummarker_locus
BNL1053(C5,C3)BNL1053(C5,C3)Gossypium hirsutummarker_locus
BNL1053_178BNL1053_178Gossypium hirsutummarker_locus
BNL1053BNL1053-66.031Gossypium hirsutummarker_locus
BNL1053BNL1053-97.81Gossypium hirsutummarker_locus
BNL1053BNL1053-95.02Gossypium hirsutummarker_locus
BNL1053BNL1053-67.189Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL1053_origBNL1053_origGossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D11chromosomeD11:17956088..17956280 -
A11chromosomeA11:21034209..21034385 -
CM018225.1chromosomeCM018225.1:16932930..16933104 -
CM018212.1chromosomeCM018212.1:20091310..20091484 -
D5_11chromosomeD5_11:49180520..49180694 +
KI_11chromosomeKI_11:12637435..12637612 -
Chr4chromosomeChr4:66348765..66348945 -
Chr11_CRI-A2_v1.0.a1chromosomeChr11_CRI-A2_v1.0.a1:102800046..102800226 +
Chr5chromosomeChr5:25377562..25377736 -
D10_11chromosomeD10_11:16403995..16404181 -
CM016624.1chromosomeCM016624.1:27236609..27236783 -
Dt_chr6chromosomeDt_chr6:25693330..25693506 +
Dt_chr7chromosomeDt_chr7:14792312..14792504 -
D11chromosomeD11:17282207..17282399 -
A11chromosomeA11:20431203..20431379 -
Ghir_D11chromosomeGhir_D11:17510863..17511055 -
Ghir_A11chromosomeGhir_A11:20882197..20882373 -
D11chromosomeD11:17067391..17067583 -
A11chromosomeA11:20197308..20197484 -
D11chromosomeD11:17519697..17519887 -
A11chromosomeA11:20603626..20603802 -
D11chromosomeD11:17304919..17305101 -
A11chromosomeA11:21028636..21028812 -
scaffold9768supercontigscaffold9768:437504..437678 +
scaffold9768supercontigscaffold9768:433847..434021 +
scaffold32528supercontigscaffold32528:83686..83860 +
Gbar_D11chromosomeGbar_D11:17218981..17219155 -
Gbar_A11chromosomeGbar_A11:19913788..19913962 -
D11chromosomeD11:17117810..17117984 -
A11chromosomeA11:20109636..20109810 -
CM017633.1chromosomeCM017633.1:17000181..17000357 -
CM017620.1chromosomeCM017620.1:20575019..20575193 -
CM017659.1chromosomeCM017659.1:17468684..17468860 -
CM017646.1chromosomeCM017646.1:20661259..20661439 -
CM017711.1chromosomeCM017711.1:17152798..17152971 -
CM017698.1chromosomeCM017698.1:20373223..20373399 -
Sequence
>BNL1053 ID=BNL1053|Name=BNL1053|organism=Gossypium hirsutum|type=genetic_marker|length=193bp
AGGGTCTGTCATGGTTGGAGTTGAAAGATTGGGAATTTTGAAAAGACTCT
AAAGTGGATTGTTCGNACTTTAGTAGCAACTAGAATGATNNGACACACAC
ACACACACACACACACACACACACAATATTTATATCATCTATATATCGAT
GCATACGTACACACATACATTGATACACACGTACGCATGCATG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part.SSZ8-4WC_D11-2N/AAD_chr.210BNL1053
23-79 x NM24016, RIL (2008)3-79 x NM24016, RIL (2008).3N-RIL_chr15N/AAD_chr.1563BNL1053
3Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c21N/AAD_chr.21113.03BNL1053
4Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch21/lgD02N/AAD_chr.2179.85BNL1053
5Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr21N/AAD_chr.2170BNL1053
6AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr11N/AAD_chr.11243BNL1053
7Xinluzao-1 x Hai-7124, F2 (2008)Xinluzao-1 x Hai-7124, F2 (2008).XH-F2_lg2N/AAD_unknown121.2BNL1053
8Yumian-1 x T586, F2:3 (2005)Yumian-1 x T586, F2:3 (2005).YT-F2:3_chr05.1N/AAD_chr.0512.6BNL1053
9AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr21N/AAD_chr.21216BNL1053
10TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c21N/AAD_chr.2167.19BNL1053
11Yumian-1 x T586, F2:7 (2008)Yumian-1 x T586, RIL (2008).YT-RIL_chr21N/AAD_chr.2181.7BNL1053
12Yumian-1 x T586, RIL (2006)YT-RIL_chr21-3N/AAD_chr.2160.6BNL1053
13DH962 x Jinmian-6, F2 (2009)DJ-F2_chrU/LG8N/AAD_chr.unknown0BNL1053
14Yumian-1 x T586, RIL (2015)YT-RIL.15_chr21N/AAD_chr.21110.1BNL1053
15DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr21-1N/AAD_chr.21121.17BNL1053
16TM-1 x 3-79, RIL (2014)T3-RIL.14_chr21N/AAD_chr.2167.2BNL1053
17TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr21N/AAD_chr.2185.9BNL1053
18GX1135 x GX100-2, F2 (2013)GG-F2_chr11-1N/AAD_chr.1149BNL1053
19GX1135 x GX100-2, RIL (2015)GG-RIL.15_chr21N/AAD_chr.21130BNL1053
20GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr21N/AAD_chr.21130BNL1053
21DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr01N/AAD_chr.0177.3BNL1053
22DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr15N/AAD_chr.1577.3BNL1053
23CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr21N/ADt.1178.8BNL1053
24CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr21N/AAD_chr.21170.2BNL1053
25CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_A03N/AAD_chr.1182.3BNL1053b
26CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_D02N/AAD_chr.21115.3BNL1053a
27HS-46 x MARCABUCAG8US-1-88, RIL (2009)HS-46 x MARCABUCAG8US-1-88, RIL (2009).HSM-RIL_chr21N/AAD_chr.210BNL1053-190
28Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_lgD02N/AAD_chr.21184.2BNL1053-190
29Yumian-1 x T586, RIL (2009)YT-RIL_chr21N/AAD_chr.2183.4BNL1053/180y(C11)
30Yumian-1 x T586, F2:3 (2005.v0)YT-F2:3_chr05-1N/AAD_chr.0512.6BNL1053(C5,C3)
31GB713 x Nem-X, F2 (2011)GN-F2_chr21N/AAD_chr.21112.3BNL1053_178
32CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr21N/ADt.1166.03BNL1053
33Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c21N/AAD_chr.2197.81BNL1053
34Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch21/lgD02N/AAD_chr.2195.02BNL1053
35TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.21N/AAD_chr.2167.19BNL1053