BNL1030, BNL1030 (genetic_marker) Gossypium hirsutum

Marker Overview
NameBNL1030
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL1030_orig
Source Typegenomic
Repeat Motif(GT)16, (CA)13
PCR ConditionAnnealing temperature: 55
Primer 1BNL1030_F: TTTGGAGCCATTTACATGCA
Primer 2BNL1030_R: AAACCACTTCTGCATCTGGA
PolymorphismP_ BNL1030
CommentPrimer data obtained in 2000
Germplasm
Stock NameType
Deltapine 90obsolete_cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL1030_FBNL1030_FGossypium hirsutumprimer
BNL1030_RBNL1030_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
boll sizeqBS.7T-ch23.e3Gossypium hirsutumQTL
fiber lengthqFL.7T-ch23.e2Gossypium hirsutumQTL
fiber lengthqFL.7T-ch23.e3Gossypium hirsutumQTL
seed indexqSI.7T-ch23.e1Gossypium hirsutumQTL
seed indexqSI.7T-ch23.e2Gossypium hirsutumQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber uniformityqFU.CY-RIL.17_ch09.kl14Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL1030BNL1030Gossypium hirsutummarker_locus
BNL1030bBNL1030bGossypium hirsutummarker_locus
BNL1030aBNL1030aGossypium hirsutummarker_locus
BNL1030-225BNL1030-225Gossypium hirsutummarker_locus
BNL1030/450y(C9)BNL1030/450y(C9)Gossypium hirsutummarker_locus
BNL1030BNL1030-100.927Gossypium hirsutummarker_locus
BNL1030aBNL1030a-90.103Gossypium hirsutummarker_locus
BNL1030bBNL1030b-91.178Gossypium hirsutummarker_locus
BNL1030aBNL1030a-150.1Gossypium hirsutummarker_locus
BNL1030bBNL1030b-194.6Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL1030_origBNL1030_origGossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D09chromosomeD09:46146983..46147219 +
A09chromosomeA09:74635715..74635945 +
CM018223.1chromosomeCM018223.1:43903612..43903850 +
CM018210.1chromosomeCM018210.1:69956954..69957178 +
D5_09chromosomeD5_09:37421374..37421606 +
Chr11chromosomeChr11:62000847..62001075 +
Chr09_CRI-A2_v1.0.a1chromosomeChr09_CRI-A2_v1.0.a1:76596745..76596973 +
Chr6chromosomeChr6:41961763..41961997 +
D10_09chromosomeD10_09:6286763..6286991 -
scaffold5426.1supercontigscaffold5426.1:22062..22292 +
Dt_chr6chromosomeDt_chr6:6505499..6505735 -
D09chromosomeD09:43992085..43992321 +
A09chromosomeA09:69004226..69004456 +
Ghir_D09chromosomeGhir_D09:45943086..45943322 +
Ghir_A09chromosomeGhir_A09:74301772..74302002 +
D09chromosomeD09:45398774..45399010 +
A09chromosomeA09:75860553..75860783 +
D09chromosomeD09:45688961..45689195 +
D09chromosomeD09:43782563..43782799 +
A09chromosomeA09:72706698..72706928 +
At09chromosomeAt09:71776176..71776400 +
scaffold1874supercontigscaffold1874:450027..450251 +
scaffold19617supercontigscaffold19617:72435..72659 -
Gbar_D09chromosomeGbar_D09:44543674..44543912 +
Gbar_A09chromosomeGbar_A09:70486615..70486839 +
D09chromosomeD09:47012662..47012900 +
A09chromosomeA09:71901048..71901272 +
CM017631.1chromosomeCM017631.1:44792473..44792711 +
CM017618.1chromosomeCM017618.1:71838243..71838473 +
CM017657.1chromosomeCM017657.1:46167199..46167429 +
CM017644.1chromosomeCM017644.1:74757941..74758169 +
CM017709.1chromosomeCM017709.1:45436857..45437099 +
CM017696.1chromosomeCM017696.1:71988727..71988961 +
Sequence
>BNL1030 ID=BNL1030|Name=BNL1030|organism=Gossypium hirsutum|type=genetic_marker|length=237bp
TTTGGAGCCATTTACATGCATAGACAATGGTAATAACAACAATAAGAGGA
AAAGAAGACCCGCAGGAACACCTGGTACGTATTATATATATATATGAAAG
CTTTTTACCCAATTATTCAAAATGGATATATGTGTGTGTGTGTGTGTGTG
TGTGTGTTTGTGTTCATGATTGGCTTTCTTTTTGTCTAATTGGAAAATAT
AATTGGGTGATGTTAGATCCAGATGCAGAAGTGGTTT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
17235 x TM-1, RIL (2007)7235 x TM-1, RIL (2007).7T-RIL_D09-1N/AAD_chr.2318.9BNL1030
2CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr09N/AAD_chr.0955.7BNL1030
3Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr09N/AAD_chr.09123.36BNL1030
4Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c09N/AAD_chr.0987.42BNL1030
5Hai-7124 x Junmian-1, BC1 (2008) partHai-7124 x Junmian-1, BC1 (2008) part.HJ-BC1_chr09N/AAD_chr.0919.5BNL1030
6AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr23N/AAD_chr.23147BNL1030
7AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr09N/AAD_chr.09155BNL1030
8Xinluzao-1 x Hai-7124, F2 (2008)Xinluzao-1 x Hai-7124, F2 (2008).XH-F2_lg13/chr09N/AAD_chr.0960.9BNL1030
9Yumian-1 x T586, F2:3 (2005)Yumian-1 x T586, F2:3 (2005).YT-F2:3_chr05.1N/AAD_chr.0550.5BNL1030
10Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c23N/AAD_chr.2399.54BNL1030
11Palmeri x K-101, F2 (2007)Palmeri x K-101, F2 (2007).PK-F2_chr09N/AAD_chr.09101.5BNL1030
12Yumian-1 x T586, RIL (2006)YT-RIL_chr09-1N/AAD_chr.0912.4BNL1030
13Yumian-1 x T586, F2:3 (2005.v0)YT-F2:3_chr05-1N/AAD_chr.0550.5BNL1030
147235 x TM-1, F2:3 (2005)7T-F2:3_chr23N/AAD_chr.2327.4BNL1030
15Yumian-1 x T586, RIL (2015)YT-RIL.15_chr09N/AAD_chr.0970.1BNL1030
16CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr09N/AAt.09125BNL1030
17CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr09N/AAD_chr.0979.7BNL1030
18Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr09N/AAD_chr.09215.5BNL1030b
19Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr23N/AAD_chr.2350BNL1030b
20TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c23N/AAD_chr.2355.03BNL1030b
21TM-1 x 3-79, RIL (2014)T3-RIL.14_chr23N/AAD_chr.2391.2BNL1030b
22Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr09N/AAD_chr.0950BNL1030a
23TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c09N/AAD_chr.0952.35BNL1030a
24Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr23N/AAD_chr.23174.4BNL1030a
25TM-1 x 3-79, RIL (2014)T3-RIL.14_chr09N/AAD_chr.0990.1BNL1030a
26TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr09N/AAD_chr.0996.5BNL1030-225
27TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr09/A9N/AAD_chr.0997.05BNL1030-225
28Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_chr09.3N/AAD_chr.0992.4BNL1030-225
29Yumian-1 x T586, RIL (2009)YT-RIL_chr09-2N/AAD_chr.0912.4BNL1030/450y(C9)
30CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr09N/AAt.09100.93BNL1030
31TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.09N/AAD_chr.0990.1BNL1030a
32TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.23N/AAD_chr.2391.18BNL1030b
33PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr09N/AAt.09150.1BNL1030a
34PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr23N/ADt.09194.6BNL1030b