BNL0686, BNL0686 (genetic_marker) Gossypium hirsutum

Marker Overview
NameBNL0686
AliasBNL686
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL0686_orig
Source Typegenomic
Repeat Motif(GA)22
PCR ConditionAnnealing temperature: 55
Primer 1BNL0686_F: ATTTTTCCCTTGGTGGTCCT
Primer 2BNL0686_R: ACATGATAGAAATATAAACCAAACACG
PolymorphismP_ BNL0686
CommentPrimer data obtained in 2000
Germplasm
Stock NameType
Deltapine 90obsolete_cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL0686_FBNL0686_FGossypium hirsutumprimer
BNL0686_RBNL0686_RGossypium hirsutumprimer


This genetic_marker is contained in the following chromosome_arm feature(s):

Feature NameUnique NameSpeciesType
9 short9 shortGossypium hirsutumchromosome_arm


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL686aBNL686aGossypium hirsutummarker_locus
BNL686BNL686Gossypium hirsutummarker_locus
BNL686bBNL686bGossypium hirsutummarker_locus
BNL0686BNL0686Gossypium hirsutummarker_locus
BNL686b*BNL686b*Gossypium hirsutummarker_locus
BNL686-156BNL686-156Gossypium hirsutummarker_locus
BNL0686aBNL0686aGossypium hirsutummarker_locus
BNL0686bBNL0686bGossypium hirsutummarker_locus
BNL686-180BNL686-180Gossypium hirsutummarker_locus
BNL686-155BNL686-155Gossypium hirsutummarker_locus
BNL686-153BNL686-153Gossypium hirsutummarker_locus
BNL686-183BNL686-183Gossypium hirsutummarker_locus
BNL0686bBNL0686b-1.812Gossypium hirsutummarker_locus
BNL0686aBNL0686a-4.242Gossypium hirsutummarker_locus
BNL686aBNL686a-32.1Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL0686_origBNL0686_origGossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D09chromosomeD09:1117632..1117789 +
A09chromosomeA09:1359526..1359711 +
CM018223.1chromosomeCM018223.1:1073573..1073716 +
CM018210.1chromosomeCM018210.1:1148123..1148311 +
D5_09chromosomeD5_09:1211730..1211886 +
Chr11chromosomeChr11:101820331..101820515 -
Chr09_CRI-A2_v1.0.a1chromosomeChr09_CRI-A2_v1.0.a1:1141267..1141451 +
Chr6chromosomeChr6:3365222..3365376 -
scaffold559.1supercontigscaffold559.1:652327..652484 -
At_chr6chromosomeAt_chr6:5557355..5557540 -
D09chromosomeD09:1165501..1165658 +
A09chromosomeA09:1124043..1124228 +
Ghir_D09chromosomeGhir_D09:1180043..1180200 +
Ghir_A09chromosomeGhir_A09:1202465..1202650 +
D09chromosomeD09:1175708..1175865 +
A09chromosomeA09:1237447..1237632 +
D09chromosomeD09:1083758..1083913 +
A09chromosomeA09:1276780..1276965 +
D09chromosomeD09:1013951..1014108 +
A09chromosomeA09:1434483..1434668 +
scaffold5942supercontigscaffold5942:160767..160955 -
Gbar_D09chromosomeGbar_D09:1059562..1059705 +
Gbar_A09chromosomeGbar_A09:1167132..1167320 +
D09chromosomeD09:1135062..1135205 +
A09chromosomeA09:1339919..1340107 +
CM017631.1chromosomeCM017631.1:1222297..1222454 +
CM017618.1chromosomeCM017618.1:1209272..1209462 +
CM017657.1chromosomeCM017657.1:1108226..1108372 +
CM017644.1chromosomeCM017644.1:1156234..1156412 +
CM017709.1chromosomeCM017709.1:1156355..1156506 +
CM017696.1chromosomeCM017696.1:1368631..1368813 +
Chr06chromosomeBNL0686:1..385 .
Chr06:1175702..1176091 +
Chr6chromosomeBNL0686:1..385 .
Chr6:3365007..3365390 -
Sequence
>BNL0686 ID=BNL0686|Name=BNL0686|organism=Gossypium hirsutum|type=genetic_marker|length=158bp
ATTTTTCCCTTGGTGGTCCTTGTTGCTGGATGAATATGGTTAATTTGTGT
CAAAAAACAAGGTGAGAAAAAGAGAAAATAATTATGGGAGAGAGAGAGAG
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGACGTGTTTGGTTTATATTTC
TATCATGT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr23N/AAD_chr.23178.9BNL686a
2Guazuncho-2 x VH8-4602, BC2 (2005)Guazuncho-2 x VH8-4602, BC2 (2005).GV-BC2_chr09N/AAD_chr.090BNL686a
3Handan-208 x Pima-90, F2:3 (2007)Handan-208 x Pima-90, F2:3 (2007).HP-F2:3_chr09N/AAD_chr.099.9BNL686a
4Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr23N/AAD_chr.2317.15BNL686
5Xinluzao-1 x Hai-7124, F2 (2008)Xinluzao-1 x Hai-7124, F2 (2008).XH-F2_lg34/chr23N/AAD_chr.2324.2BNL686
6Zhongmiansuo-12 x 8891, RIL (2007)Zhongmiansuo-12 x 8891, RIL (2007).Z8-RIL_ch09/A09-1N/AAD_chr.090BNL686
7TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr23N/AAD_chr.2323.8BNL686
8CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr23N/ADt.093.1BNL686
9Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr23N/AAD_chr.2351.3BNL686b
10Guazuncho-2 x VH8-4602, BC2 (2005)Guazuncho-2 x VH8-4602, BC2 (2005).GV-BC2_chr23N/AAD_chr.235.2BNL686b
11PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr09N/AAt.090BNL686b
12Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c09N/AAD_chr.0919.5BNL0686
13Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch23N/AAD_chr.232.64BNL0686
14Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch09N/AAD_chr.093.29BNL0686
15AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr23N/AAD_chr.2324BNL0686
16AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr09N/AAD_chr.091BNL0686
17Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c23N/AAD_chr.235.35BNL0686
18Handan-208 x Pima-90, F2:3 (2007)Handan-208 x Pima-90, F2:3 (2007).HP-F2:3_chr23N/AAD_chr.2334.3BNL686b*
19HS-46 x MARCABUCAG8US-1-88, RIL (2009)HS-46 x MARCABUCAG8US-1-88, RIL (2009).HSM-RIL_chr23N/AAD_chr.230BNL686-156
20Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr09N/AAD_chr.09170BNL0686a
21TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c23N/AAD_chr.23141.35BNL0686a
22TM-1 x 3-79, RIL (2014)T3-RIL.14_chr09N/AAD_chr.091.8BNL0686a
23TM-1 x 3-79, RIL (2014)T3-RIL.14_chr23N/AAD_chr.234.2BNL0686a
24Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr23N/AAD_chr.23130BNL0686b
25TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c09N/AAD_chr.09139.43BNL0686b
26TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr09N/AAD_chr.090BNL686-180
27TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr09/A9N/AAD_chr.090BNL686-180
28TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr23N/AAD_chr.2325.4BNL686-155
29TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr23/D9N/AAD_chr.2324.31BNL686-155
30Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_chr09.2N/AAD_chr.090BNL686-153
31Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_chr09.2N/AAD_chr.0910BNL686-183
32TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.09N/AAD_chr.091.81BNL0686b
33TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.23N/AAD_chr.234.24BNL0686a
34PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr23N/ADt.0932.1BNL686a
Image
File NameLegend
48_FISH_TAG-115-675.jpgTwenty-six individual cotton mitotic chromosomes with FISH signals derived from the chromosome-speciWc BACs, and comparisons of linkage and FISH maps. [Image from Wang 2007, TAG-115-675]