CGR5250, CGR5250 (genetic_marker) Gossypium hirsutum

Marker Overview
NameCGR5250
Genbank IDGQ393363
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 33 B
Source SequenceMONCS0328
Source Typegenomic
PCR ConditionAnnealing temperature: 55
Primer 1CGR5250_F: TATTCCGAATTCGACCTGCT
Primer 2CGR5250_R: TTGAGGCTTAGAATTGCAGA
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
Germplasm
Stock NameType
Deltapine 33 BTBD
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CGR5250_FCGR5250_FGossypium hirsutumprimer
CGR5250_RCGR5250_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CGR5250CGR5250Gossypium hirsutummarker_locus
CGR5250CGR5250-24.681Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
MONCS0328MONCS0328Gossypium hirsutumsequence_feature


Contact
NameDetails
Monsanto
Country:United States
Sequence
>CGR5250 ID=CGR5250|Name=CGR5250|organism=Gossypium hirsutum|type=genetic_marker|length=150bp
TATTCCGAATTCGACCTGCTTAAGGATATAAAATTTGTAACATTAATCCA
TGGTAGAATCACAAGAAAAAGCAAAAGAAGAAGAAGAAGAAGAAGAAGAA
GAAGAAGAAGAAGAACTCTAACCTTCTTTATCTGCAATTCTAAGCCTCAA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr02N/AAD_chr.0270CGR5250View
2Yumian-1 x T586, RIL (2015)YT-RIL.15_chr14N/AAD_chr.1416.2CGR5250View
3W10 x TM-1, F2:3 (2015)WT-F2:3_chr02-1N/AAD_chr.0278.1CGR5250View
4CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr02N/AAD_chr.0285.1CGR5250View
5CCRI-36 x G2005, RIL (2016)CG-RIL_chr02N/AAD_chr.020CGR5250View
6CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr02N/AAt.0224.68CGR5250-24.681View
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ393363