SWU17852, SWU17852 (genetic_marker) Gossypium raimondii

Marker Overview
NameSWU17852
Genbank IDN/A
TypeSSR
SpeciesGossypium raimondii
Primer 1SWU17852_F: CTTGGCATCTTCCCTTTTTC
Primer 2SWU17852_R: CGGATTCTACTTTCTCCCCA
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SWU17852_FSWU17852.SWU17852_FGossypium raimondiiprimer
SWU17852_RSWU17852.SWU17852_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SWU17852SWU17852-53.194Gossypium raimondiimarker_locus
SWU17852SWU17852Gossypium raimondiimarker_locus


Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr05N/AAt.0553.19SWU17852View
2901-001 x sGK156, F2 (2019)Chr05N/AAD_chr.050SWU17852View