PXP0018, PXP0018 (genetic_marker) Gossypium barbadense

Marker Overview
NamePXP0018
Genbank IDAF060577
TypeRFLP
SpeciesGossypium barbadense
GermplasmPima S-6
Source TypeGenomic
Publication[view all]
Germplasm
Stock NameType
Pima S-6cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankAF060577
Sequence
>PXP0018 ID=PXP0018|Name=PXP0018|organism=Gossypium barbadense|type=genetic_marker|length=526bp
CTACAAAACTCCAAATCACTAGCCGTTAATTTTCCCTGAATAGAGACTCA
TATATCTTCCATCCATAAAATTTTCAAAATTTTTTGGTTGGCCAATCAAT
ACCAGATTTCTCTTAAAGTTTCCCCTGTTTCACTGTTTGACTATTCTGAC
CACTCTTCACTACGAATCAGATTTCTCATTTCACAGAATTAAAAATGTGT
TGTATTTGATCTCATTTGAAACTAGACTCATTAAGGAGTCTAAGCATATA
AATTTTATCTTATAATCATCTCTGGACAATTTATAATGATTTCCTAAAAA
CAGAACAGGGAATCTAGTAGTCATTTTGACTCAGACCCACAATACTTCAA
ATATCTCAAGATCGGCAACTCTTTGGTCCCCATAGCCTCTTTCGGCAGAA
ATAGACTCTTCAGCCTTCATGGAATAATCACTCAGCTTCTAATTCACTCC
CACAAATTATGGGGATTTCCACATCACCCCAATGNTGTGCCCCAACAGAT
TATTCCACTCAATACTTACATAGGAT
Image
File NameLegend
39_FISH_AJB-85-1364.jpgFISH photomicrographs of Gossypium hirsutum repetitive elements hybridized to metaphase chromosomes of G. hirsutum, G. arboreum, G. raimondii, and an A2D5 synthetic diploid. [Image from Hanson et al., 1998, AJB-85-1364]