SWU19721, SWU19721 (genetic_marker) Gossypium raimondii

Marker Overview
NameSWU19721
Genbank IDN/A
TypeEST-SSR
SpeciesGossypium raimondii
Primer 1SWU19721_F: GCTTCCATTATTCTGCTCCC
Primer 2SWU19721_R: GGGTTTTTGGAATGAGGAGA
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SWU19721_FSWU19721.SWU19721_FGossypium raimondiiprimer
SWU19721_RSWU19721.SWU19721_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SWU19721SWU19721Gossypium raimondiimarker_locus


Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
10-153 x sGK9708, RIL (2015)0s-RIL.15_chr25N/AAD_chr.256.98SWU19721View
20-153 x sGK9708, RIL (2016)0s-RIL_chr25-1N/AAD_chr.25177.1SWU19721View