CCRI_SNP182632, CCRI_SNP182632 (genetic_marker) Gossypium spp.

Marker Overview
NameCCRI_SNP182632
dbSNP IDN/A
TypeSNP
SNP AllelesT/C
SpeciesGossypium spp.
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CRI-SNP182632CRI-SNP182632Gossypium spp.marker_locus


Sequence
>CCRI_SNP182632 ID=CCRI_SNP182632|Name=CCRI_SNP182632|organism=Gossypium spp.|type=genetic_marker|length=170bp
TAGAGAAATAACTCAATTTTTAAGAGAAAAAGAGAAAACGCGTCCTACTG
AACGCATTTTCTATTGAGGTGGCTGAAAGCXXXXXXXXXXACAATTGCAT
TTGTGTTTGAGGTAAACATTGTGATAGCTTAAAGGTATATTTGAGTTAAC
AGTGATGCTATAGTGCTTGG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
10-153 x sGK9708, RIL (2015)0s-RIL.15_chr25N/AAD_chr.2520.41CRI-SNP182632View