SWU20757, SWU20757 (genetic_marker) Gossypium hirsutum

Marker Overview
NameSWU20757
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
Primer 1SWU20757_F: AAGGCATGACGTACTTGACAG
Primer 2SWU20757_R: CTGAAGGAATTGCTTGCTTG
Publication[view all]
Relationships

This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber elongationqFEL.CY-RIL.17_ch22.kl15Gossypium hirsutumQTL
lint percentqLP.CY-RIL.17_ch22.ay15Gossypium hirsutumQTL


This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SWU20757_FSWU20757.SWU20757_FGossypium hirsutumprimer
SWU20757_RSWU20757.SWU20757_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SWU20757bSWU20757b-218.444Gossypium hirsutummarker_locus
SWU20757SWU20757Gossypium hirsutummarker_locus


Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr05N/AAt.05218.44SWU20757bView
2CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr22N/ADt.040SWU20757View
3901-001 x sGK156, F2 (2019)Chr04N/AAD_chr.040SWU20757View