SWU16573, SWU16573 (genetic_marker) Gossypium hirsutum

Marker Overview
NameSWU16573
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
Primer 1SWU16573_F: AATCGCCCATCCAAACTTAC
Primer 2SWU16573_R: TGGGGATTACTCTATAGCATGG
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SWU16573_FSWU16573.SWU16573_FGossypium hirsutumprimer
SWU16573_RSWU16573.SWU16573_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SWU16573SWU16573Gossypium hirsutummarker_locus
SWU16573SWU16573-144.617Gossypium hirsutummarker_locus


Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-35 x TX-41, F2 (2020)CT-F2_chr21N/AAD_chr.21131.2SWU16573View
2GX1135 x GX100-2, RIL (2015)GG-RIL.15_chr21N/AAD_chr.2123.1SWU16573View
3GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr21N/AAD_chr.2123.6SWU16573View
4CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr21N/ADt.11144.62SWU16573View