SWU12126, SWU12126 (genetic_marker) Gossypium hirsutum

Marker Overview
NameSWU12126
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
Repeat Motif(TA)12
Primer 1SWU12126_F: GTGTGCAAATGGAACGAATC
Primer 2SWU12126_R: CCTTGTCCATGACACAAATG
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SWU12126_FSWU12126.SWU12126_FGossypium hirsutumprimer
SWU12126_RSWU12126.SWU12126_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SWU12126SWU12126Gossypium hirsutummarker_locus


Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1GX1135 x GX100-2, RIL (2015)GG-RIL.15_chr02-1N/AAD_chr.020SWU12126View
2GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr02-1N/AAD_chr.020SWU12126View