SWU11976, SWU11976 (genetic_marker) Gossypium hirsutum

Marker Overview
NameSWU11976
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
Primer 1SWU11976_F: CTCAATCAGAATCGACACCA
Primer 2SWU11976_R: CAGCGATGAAACCATCAAAG
Publication[view all]
Relationships

This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
micronaireqMIC.GG-RIL.15_ch02-1.xy12Gossypium hirsutumQTL
fiber elongationqFEL.GG-RIL.16_ch02-1.xy12-bc.1Gossypium hirsutumQTL
micronaireqMIC.GG-RIL.16_ch02-1.xy12Gossypium hirsutumQTL
2.5 span lengthqSL2.5.GG-RIL.16_ch02-1.xy12Gossypium hirsutumQTL
micronaireqMIC.GG-RIL.15_ch02-1.cz12Gossypium hirsutumQTL
micronaireqMIC.GG-RIL.16_ch02-1.cz12.1Gossypium hirsutumQTL
micronaireqMIC.GG-RIL.16_ch02-1.cz12-bc.1Gossypium hirsutumQTL
micronaireqMIC.GG-RIL.16_ch02-1.cz12.2Gossypium hirsutumQTL
micronaireqMIC.GG-RIL.16_ch02-1.xy12-bcGossypium hirsutumQTL
seed indexqSI.GG-RIL.16_ch02-1.xy12-rilGossypium hirsutumQTL
seed indexqSI.GG-RIL.16_ch02-1.xy12-ril'.2Gossypium hirsutumQTL
2.5 span lengthqSL2.5.GVG-RIL_ch02-1.hd12Gossypium hirsutumQTL
2.5 span lengthqSL2.5.GVG-RIL_ch02-1.cz12.2Gossypium hirsutumQTL
2.5 span lengthqSL2.5.GVG-RIL_ch02-1.xy12.2Gossypium hirsutumQTL
2.5 span lengthqSL2.5.GVG-RIL_ch02-1.xy12.3Gossypium hirsutumQTL
2.5 span lengthqSL2.5.GVG-RIL_ch02-1.xy12-bcGossypium hirsutumQTL


This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SWU11976_FSWU11976.SWU11976_FGossypium hirsutumprimer
SWU11976_RSWU11976.SWU11976_RGossypium hirsutumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
upper half mean lengthqUHML.CY-RIL.17_ch17.ay14Gossypium hirsutumQTL
upper half mean lengthqUHML.CY-RIL.17_ch17.ez14Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SWU11976SWU11976Gossypium hirsutummarker_locus
SWU11976SWU11976-28.561Gossypium hirsutummarker_locus


Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1GX1135 x GX100-2, RIL (2015)GG-RIL.15_chr02-1N/AAD_chr.0258SWU11976View
2GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr02-1N/AAD_chr.0257.9SWU11976View
3GX1135 x VGX100-2, RIL (2016)GVG-RIL_chr02-1N/AAD_chr.02113.1SWU11976View
4CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr17N/ADt.0328.56SWU11976View