SWU10987, SWU10987 (genetic_marker) Gossypium hirsutum

Marker Overview
NameSWU10987
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
Primer 1SWU10987_F: CGTGGGCATTGTGTTATCTC
Primer 2SWU10987_R: CCCTAAGGTCGTTGGAAGAA
Publication[view all]
Relationships

This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber strengthqFS.GG-RIL.16_ch01-1.hd12Gossypium hirsutumQTL


This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SWU10987_FSWU10987.SWU10987_FGossypium hirsutumprimer
SWU10987_RSWU10987.SWU10987_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SWU10987SWU10987Gossypium hirsutummarker_locus
SWU10987SWU10987-19.992Gossypium hirsutummarker_locus


Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr01-1N/AAD_chr.0147.8SWU10987
20-153 x sGK9708, RIL (2016)0s-RIL_chr01-1N/AAD_chr.0116.6SWU10987
3CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr15N/ADt.0119.99SWU10987