CRIBIO_1008, CRIBIO_1008 (genetic_marker) Gossypium hirsutum

Marker Overview
NameCRIBIO_1008
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
Primer 1CRIBIO1008_F: TGCAGACCTCAAAATCACTCC
Primer 2CRIBIO1008_R: TTGACATTTTGGCGTCACAT
Publication[view all]
ContactLi, Fu-Guang
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CRIBIO1008_FCRIBIO_1008.CRIBIO1008_FGossypium hirsutumprimer
CRIBIO1008_RCRIBIO_1008.CRIBIO1008_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CRIBIO1008CRIBIO1008Gossypium hirsutummarker_locus


Contact
NameDetails
Li, Fu-Guang
First name:Fu-Guang
Last name:Li
Title:Vice- President
Institution:Cotton Research Institute, Chinese Academy of Agricultural Sciences
Address:Development Area Yellow River Road, Anyang, Henan 455000
Country:China
Email:lifug@cricaas.com.cn
Phone:0086-372-2562204
Fax:0086-372-2562256
Last update:22-Nov-2007
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1W10 x TM-1, F2:3 (2015)WT-F2:3_chr02-1N/AAD_chr.02156.4CRIBIO1008View