SWU16626, SWU16626 (genetic_marker) Gossypium raimondii

Marker Overview
NameSWU16626
Genbank IDN/A
TypeEST-SSR
SpeciesGossypium raimondii
Repeat Motif(TACA)8
Primer 1SWU16626_F: GCCTTCTTGCATCTTTCCAG
Primer 2SWU16626_R: GGTCAGCTGATGCCTAATGT
Publication[view all]
Commentprimer in pub 21975 TbS1
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SWU16626_FSWU16626.SWU16626_FGossypium raimondiiprimer
SWU16626_RSWU16626.SWU16626_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
swu16626swu16626Gossypium raimondiimarker_locus
swu16626swu16626-124.4Gossypium raimondiimarker_locus


Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-35 x TX-41, F2 (2020)CT-F2_chr21N/AAD_chr.21163.7swu16626View
2D3K-57 x D3D-1, F2:3 (2018)D3.KD-F2:3_chr07N/AD_chr.0757.76swu16626View
3D3K-57 x D3D-1, F2:3-P (2018)D3.KD-F2:3-P_chr07N/AD_chr.0760228473swu16626View
4D3K-57 x D3D-1, F2:3 (2018)D3.KD-F2:3_chr07N/AD_chr.07124.4swu16626View