HAU-J6039, HAU-J6039 (genetic_marker) Gossypium hirsutum

Marker Overview
NameHAU-J6039
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
Repeat Motif(TA)8
Primer 1HAU-J6039_F: AATTCCTAGCTTTGCCCCTA
Primer 2HAU-J6039_R: TGATGGCAGACCTGAAGATT
Publication[view all]
ContactLin, Zhong-Xu
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
HAU-J6039_FHAU-J6039.HAU-J6039_FGossypium hirsutumprimer
HAU-J6039_RHAU-J6039.HAU-J6039_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
HAU-J6039HAU-J6039Gossypium hirsutummarker_locus


Contact
NameDetails
Lin, Zhong-Xu
First name:Zhong-Xu
Last name:Lin
Address:shizishan 1, wuhan, hubei 430070
Country:China
Email:linzhongxu@mail.hzau.edu.cn
Phone:+86 027 87283955
Last update:5-Mar-2007
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr01N/AAD_chr.0135.1HAU-J6039
2DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr15-1N/AAD_chr.1535.1HAU-J6039
3DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr01N/AAD_chr.0131.3HAU-J6039
4DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr15N/AAD_chr.1531.3HAU-J6039