Kirkii_Juiced.00g074740, Kirkii_Juiced.00g074740_ISU-kirkii_v3.0.a3 (gene) Gossypioides kirkii

Overview
NameKirkii_Juiced.00g074740
Unique NameKirkii_Juiced.00g074740_ISU-kirkii_v3.0.a3
Typegene
OrganismGossypioides kirkii ()
Sequence length2472
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
Kirkii_Juiced.00g074740.m01Kirkii_Juiced.00g074740.m01_ISU-kirkii_v3.0.a3Gossypioides kirkiimRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Gossypioides kirkii genome ISU_v3_a32019-02-28
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
KI_03chromosomeKI_03:37907071..37909542 -
Properties
Property NameValue
Original IDKirkii_Juiced.00g074740
Original nameKirkii_Juiced.00g074740
Sequences
The following sequences are available for this feature:

gene sequence

>Kirkii_Juiced.00g074740_ISU-kirkii_v3.0.a3 ID=Kirkii_Juiced.00g074740_ISU-kirkii_v3.0.a3|Name=Kirkii_Juiced.00g074740|organism=Gossypioides kirkii|type=gene|length=2472bp
ATGGATCGATGGCTCAAGCTTTCCGTACTAGTCTTTATGTGGTTTTCTTT
CGACAGCCAACTCTCCTTAGGAGCAGACACCATCTCAGCAAATCAGTCTC
TCTCCGGTAGTCAGACCCTTGTTTCATCGGGTGGAAACTTCGTGTTGGGC
TTCTTCAGACCAGGTAATTCTTCCAACCAGTACATAGGCATATGGTACGG
CAACAAGGTCACTCAACGAACCCCAGTTTGGGTTGCAAACAGAGAGATAC
CCGTCCGTGATACAGAATCTTCTGAACTAAAAATATCTGATGGTAACTTG
GTTTTGTTCAACGAGTCCAAAGTACCAATTTGGTCCACCAATATTAGCTC
AAGCAGCTCAAGTTCTGTAGTGGCAGTCCTTGAAGATACTGGGAATCTTG
TTCTAAGAGATGGTCCCAATTCAACAGCACCTTTGTGGCAAAGTTTGGAT
AATCCCACACACACATGGCTTCCTGGTGGTAAGATTAGCTTAAATAAACG
GACCAATCAAAGTCAACTTCTTATTTCATGGAAAAATTCAGAAGATCCTG
CGCCGGGTCTCTTCTCTCTGGAGCTAGATCCAGACGGAACCAATCAATAT
TTGATTATGTGGAATAGGACCAGACAGTACTGGACGAGTGGACCTTGGGA
TGAACAAGCAAGGATTTTCAGCTTAGTTCCAGAAATGAGATTGAATTATA
TTTACAACTTCAGCTTTTATTCAGACGAAAACGAGAGTTATTTTACTTAT
TCGCTTTATGATCCTAGGACCATATCTCGATTTGTTATGGATATCTCGGG
GCAGATTAAGCAACTGTCTTGGTTGGATAGTAGCAAGGAGTGGAATTTGT
TTTGGTCACAGCCGAGACAACAGTGCGAGGTTTATGCTTATTGTGGGGCT
TTTGGCAGCTGCAACGAGGGAGGTTTGCCTTTCTGTACTTGTTTGAGAGG
TTTCCATCAAAAATCGCAATCGGCTTGGAATCTGAGCGATTTTTCTGATG
GGTGTGAAAGGACAAACAAGCTGCAGTGCGAGGAGAATGCCACCCTTGCT
AATGGAAAGCCTGATAAATTTCTCACTAACCCCTACGTGAAATTGCCGCA
AAATGCTCAGTCTATGAACGCTACGAGCATGTCGGAATGTGAATCAACCT
GCCTTCATAATTGCTCTTGCACTGCTTATGCTTATGACAGTGATGGTTGT
AGAATTTGGATAGGCCAACTCTTGGATCTGCAACAACTTGCGAATGATGA
CAGCGATGGCAAAACTCTATATCTCCGATTAGCGGCATCTGAATTTTCCA
GTTCCGGCAACAATAATGGAATCATTATTGGAGCAGCTGCAGGGTCGGTG
AGTTTAGTCCTACTCCTTGTAATATTTGGAATCTGGAGATGGAGGCGGCG
GACAACAATTAATCCGAAAGCTGTTGAAGGCTCACTTCTAGCTTTCGGAT
ATAGGGATTTACAGAGTGCAACCAAGAATTTCTCTGAAAAGCTTGGGGGA
GGAGGCTTTGGTTCTGTTTTCAAAGGAACGTTGCCAGACTCGAGTGTCAT
CGCTGTGAAGCAGCTTGACAGCATCAGTCAGGGAGAGAAGCAGTTCCGCA
CAGAGGTCAGCACAATTGGGACGATCCAGCATGTTAACCTAGTGCGGCTT
CGAGGGTTCTGCTCTGAAGGTACAAGGAAGCTGTTGGTGTATGATTACAT
GCCAAATGGTTCTTTGGATGCCCATCTTTTCCATGAAGAGAATTCTAAAG
CTCTAACCTGGAAAATAAGGTACCAGATTGCACTTGGTACGGCTAGAGGC
TTAGCTTATCTTCATGAGAAGTGCAGAGATTGTATTATTCACTGTGACAT
CAAGCCAGAGAACATTCTCTTGGATGCTGAATTCTGTCCCAAAGTCGCAG
ATTTTGGCCTGGCAAAGCTTATCGGGCGGGACTTCAGCAGGGCCCTGACA
ACTATGAGAGGGACAAGGGGCTATCTTGCACCCGAGTGGATTTCAGGAGT
CCCGGTTACAGCTAAAGCTGATGTCTACAGCTACGGGATGATGCTGTTTG
AGTTTGTGTCAGGAAGGAGAAACTCTGAACAATCTGAAGATGGAAAAGTT
AGATTCTTTCCGACTTTGGCTGCTAGCGTAATAACCCAAGACGATGATGT
GCTAACCCTATTAGACCCCCAATTGAATGGAGATGCCCCTGAAGAAGAGC
TATCAAAAATATGTAAAGTGGCCTGTTGGTGTGTCCAAGATGATGAAGCT
CACAGGCCAGCAATGGGTCAGGTTGTTCAGATCCTAGAGGGTGTTTTGGA
AGTGAACCTGCCTCCAATTCCGAAGTTTCTACAAGTGCTCGCGGACAATT
CTGAGCATGTTATCTTCTTCACAGAGTCATCTTCAAACCAGAGTTCGGAG
ACACCGAGCTACACTTCAACTGCGTCTTCTCAGGCTAAGAGTAACACATC
ATCAATCATTCATGAATCTTGA
back to top

gene from alignment at KI_03:37907071..37909542-

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>Kirkii_Juiced.00g074740_ISU-kirkii_v3.0.a3 ID=Kirkii_Juiced.00g074740_ISU-kirkii_v3.0.a3|Name=Kirkii_Juiced.00g074740|organism=Gossypioides kirkii|type=gene|length=2472bp|location=Sequence derived from alignment at KI_03:37907071..37909542- (Gossypioides kirkii)
ATGGATCGATGGCTCAAGCTTTCCGTACTAGTCTTTATGTGGTTTTCTTT CGACAGCCAACTCTCCTTAGGAGCAGACACCATCTCAGCAAATCAGTCTC TCTCCGGTAGTCAGACCCTTGTTTCATCGGGTGGAAACTTCGTGTTGGGC TTCTTCAGACCAGGTAATTCTTCCAACCAGTACATAGGCATATGGTACGG CAACAAGGTCACTCAACGAACCCCAGTTTGGGTTGCAAACAGAGAGATAC CCGTCCGTGATACAGAATCTTCTGAACTAAAAATATCTGATGGTAACTTG GTTTTGTTCAACGAGTCCAAAGTACCAATTTGGTCCACCAATATTAGCTC AAGCAGCTCAAGTTCTGTAGTGGCAGTCCTTGAAGATACTGGGAATCTTG TTCTAAGAGATGGTCCCAATTCAACAGCACCTTTGTGGCAAAGTTTGGAT AATCCCACACACACATGGCTTCCTGGTGGTAAGATTAGCTTAAATAAACG GACCAATCAAAGTCAACTTCTTATTTCATGGAAAAATTCAGAAGATCCTG CGCCGGGTCTCTTCTCTCTGGAGCTAGATCCAGACGGAACCAATCAATAT TTGATTATGTGGAATAGGACCAGACAGTACTGGACGAGTGGACCTTGGGA TGAACAAGCAAGGATTTTCAGCTTAGTTCCAGAAATGAGATTGAATTATA TTTACAACTTCAGCTTTTATTCAGACGAAAACGAGAGTTATTTTACTTAT TCGCTTTATGATCCTAGGACCATATCTCGATTTGTTATGGATATCTCGGG GCAGATTAAGCAACTGTCTTGGTTGGATAGTAGCAAGGAGTGGAATTTGT TTTGGTCACAGCCGAGACAACAGTGCGAGGTTTATGCTTATTGTGGGGCT TTTGGCAGCTGCAACGAGGGAGGTTTGCCTTTCTGTACTTGTTTGAGAGG TTTCCATCAAAAATCGCAATCGGCTTGGAATCTGAGCGATTTTTCTGATG GGTGTGAAAGGACAAACAAGCTGCAGTGCGAGGAGAATGCCACCCTTGCT AATGGAAAGCCTGATAAATTTCTCACTAACCCCTACGTGAAATTGCCGCA AAATGCTCAGTCTATGAACGCTACGAGCATGTCGGAATGTGAATCAACCT GCCTTCATAATTGCTCTTGCACTGCTTATGCTTATGACAGTGATGGTTGT AGAATTTGGATAGGCCAACTCTTGGATCTGCAACAACTTGCGAATGATGA CAGCGATGGCAAAACTCTATATCTCCGATTAGCGGCATCTGAATTTTCCA GTTCCGGCAACAATAATGGAATCATTATTGGAGCAGCTGCAGGGTCGGTG AGTTTAGTCCTACTCCTTGTAATATTTGGAATCTGGAGATGGAGGCGGCG GACAACAATTAATCCGAAAGCTGTTGAAGGCTCACTTCTAGCTTTCGGAT ATAGGGATTTACAGAGTGCAACCAAGAATTTCTCTGAAAAGCTTGGGGGA GGAGGCTTTGGTTCTGTTTTCAAAGGAACGTTGCCAGACTCGAGTGTCAT CGCTGTGAAGCAGCTTGACAGCATCAGTCAGGGAGAGAAGCAGTTCCGCA CAGAGGTCAGCACAATTGGGACGATCCAGCATGTTAACCTAGTGCGGCTT CGAGGGTTCTGCTCTGAAGGTACAAGGAAGCTGTTGGTGTATGATTACAT GCCAAATGGTTCTTTGGATGCCCATCTTTTCCATGAAGAGAATTCTAAAG CTCTAACCTGGAAAATAAGGTACCAGATTGCACTTGGTACGGCTAGAGGC TTAGCTTATCTTCATGAGAAGTGCAGAGATTGTATTATTCACTGTGACAT CAAGCCAGAGAACATTCTCTTGGATGCTGAATTCTGTCCCAAAGTCGCAG ATTTTGGCCTGGCAAAGCTTATCGGGCGGGACTTCAGCAGGGCCCTGACA ACTATGAGAGGGACAAGGGGCTATCTTGCACCCGAGTGGATTTCAGGAGT CCCGGTTACAGCTAAAGCTGATGTCTACAGCTACGGGATGATGCTGTTTG AGTTTGTGTCAGGAAGGAGAAACTCTGAACAATCTGAAGATGGAAAAGTT AGATTCTTTCCGACTTTGGCTGCTAGCGTAATAACCCAAGACGATGATGT GCTAACCCTATTAGACCCCCAATTGAATGGAGATGCCCCTGAAGAAGAGC TATCAAAAATATGTAAAGTGGCCTGTTGGTGTGTCCAAGATGATGAAGCT CACAGGCCAGCAATGGGTCAGGTTGTTCAGATCCTAGAGGGTGTTTTGGA AGTGAACCTGCCTCCAATTCCGAAGTTTCTACAAGTGCTCGCGGACAATT CTGAGCATGTTATCTTCTTCACAGAGTCATCTTCAAACCAGAGTTCGGAG ACACCGAGCTACACTTCAACTGCGTCTTCTCAGGCTAAGAGTAACACATC ATCAATCATTCATGAATCTTGA
back to top
Synonyms
The feature 'Kirkii_Juiced.00g074740' has the following synonyms
Synonym
Kirkii_Juiced.00g074740