trnC-GCA, NC_016692.1-trnC-GCA (gene) Gossypium herbaceum

Overview
NametrnC-GCA
Unique NameNC_016692.1-trnC-GCA
Typegene
OrganismGossypium herbaceum (Cotton (G. herbaceum))
Cross References
External references for this gene
DatabaseAccession
GeneID11539596
nuccoreNC_016692.1
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
trnC-GCAtrnC-GCAGossypium herbaceumgene


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2019-03-14
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
NC_016692regionNC_016692:28868..28948 +
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>NC_016692.1-trnC-GCA ID=NC_016692.1-trnC-GCA|Name=trnC-GCA|organism=Gossypium herbaceum|type=gene|length=81bp
ggcgacatggccgagcggtaaggcgggggactgcaaatcccttattcccc
agttcaaatccgggtgtcgcctgatcaacaa
back to top