psbK, NC_016692.1-psbK (gene) Gossypium herbaceum

Overview
NamepsbK
Unique NameNC_016692.1-psbK
Typegene
OrganismGossypium herbaceum (Cotton (G. herbaceum))
Cross References
External references for this gene
DatabaseAccession
GeneID11539567
nuccoreNC_016692.1
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
psbKpsbKGossypium herbaceumgene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
psbKNC_016692.1-psbK.m5Gossypium herbaceummRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2019-03-14
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
NC_016692regionNC_016692:7378..7563 +
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>NC_016692.1-psbK ID=NC_016692.1-psbK|Name=psbK|organism=Gossypium herbaceum|type=gene|length=186bp
atgcttaatatctttaatttgatctgtatctgttttaattctgccctttt
ttcgagtagttttttattcgccaaattgcccgaggcctatgcttttttga
atccaatcgtagattttatgccagtaatacctgttctcttttttctctta
gcctttgtttggcaagctgctgtaagttttcgatga
back to top

gene from alignment at NC_016692:7378..7563+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>NC_016692.1-psbK ID=NC_016692.1-psbK|Name=psbK|organism=Gossypium herbaceum|type=gene|length=186bp|location=Sequence derived from alignment at NC_016692:7378..7563+ (Gossypium herbaceum)
atgcttaatatctttaatttgatctgtatctgttttaattctgccctttt ttcgagtagttttttattcgccaaattgcccgaggcctatgcttttttga atccaatcgtagattttatgccagtaatacctgttctcttttttctctta gcctttgtttggcaagctgctgtaagttttcgatga
back to top