rpoC1, NC_023215.1-rpoC1 (gene) Gossypium herbaceum

Overview
NamerpoC1
Unique NameNC_023215.1-rpoC1
Typegene
OrganismGossypium herbaceum (Cotton (G. herbaceum))
Cross References
External references for this gene
DatabaseAccession
GeneID18126899
nuccoreNC_023215.1
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
rpoC1rpoC1Gossypium herbaceumgene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
rpoC1NC_023215.1-rpoC1.m13Gossypium herbaceummRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2019-03-14
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
NC_023215regionNC_023215:21548..24366 -
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>NC_023215.1-rpoC1 ID=NC_023215.1-rpoC1|Name=rpoC1|organism=Gossypium herbaceum|type=gene|length=2819bp
atgatcgaccgatataaacatcaacaactccgaattggatcagtttctcc
ccaacaaataagtgcttgggccaagaaaatcctacctaatggagaaaccg
ttggagaggtgacaaaaccctatacttttcattacaaaaccaataaaccg
gaaaaggatggattattttgtgaaagaatttttggacctataaaaagtgg
aatttgcgcttgtggaaattatcgagtaattggaaatcaaaaggagggcc
ctaaattttgtgaacaatgcggagttgaatttgttgattctcggatacga
agatatcaaatgggatacataaggctggcatgtccagtaactcatgtatg
gtatttgaaacgccttcctagttatatcgccaatcttttagacaaacctc
ttaaagaattagagggtctagtatactgcgatgtgtgatttgatcgaaat
tattattttacagattaggaatgagaaactgtcatcccattcaatcgaat
tgggatgccctggatctgacatgtctcttgggaagagtaacatgaagctc
agaattatgggcgtattcaatactcccaaataaaaagggaattggtctat
ggtcgagtcagtaaaaataaataactaggaattttgagttgtacctcgtg
aaaaaaagacttcttttttttgtggaattaaccgttctcatttcttttag
ttcttttagaaagaaatgaaattatgttcaaggaaacaaatatgtcatgg
ttgcaggagtctatacatcgcatataggcttaggctttaagttaagggca
tcgtggtataatcgtcgaggtaccgcaggacctaagagatcgaatggaag
ggtacatagacaagtaaatcccttatgacactcctttaattttagaggat
tcagcattcgaggggaagtagactactcaagaatttcacatttcatttat
gtcctaattttgaattgaataaagaattaagaaaatctaaatcaataaat
caataaaagaagaatcaatcaatgaaatgtttcttggaacttgagtaaag
agtagaccttttttgggggttctagaatttgaaagcgagaactcctttac
tttatctttatttggtgtaactacttgagccggatgagaggaaactctca
tgtccgattttgagggggggatcccgcagggccctatcctaatttttctt
ttgctaggcccatcgctaaaaaacctactttcttacgattacgaggttca
ttcgaatatgaaattcaatcctggaaatacagtatcccacttttttttac
tacccaaggtttcgatacatttcgaagtcgcgaaatttctaccggagcag
gtgctattcgagaacaattagccgatctagatttgcgaattcttatcgat
tattcggtggtagaatggaaagaattaggagaagaaggcctcacgggtaa
tgaatgggaagatcgaaaaattggaagaagaaaggattttttggttagac
gcatggaattggctaagcattttattcgaacaaatatagaaccagaatgg
atggttttatgtctattaccggttcttcctcccgagttgagaccgatcat
tcagatagatgggggtaaactaatgagttcggatattaatgaactctata
gaagagttatctatcgaaataatactcttaccgatctattaacaacaagt
agatctacgccaggggaattagtaatgtgtcaggaaaaattagtacaaga
agccgtggatacacttcttgataatggaatccgcggacaaccaatgaggg
acggtcataataaggtttacaagtcgttttcagatgtaattgaaggcaaa
gagggaagatttcgcgagactttgcttggcaaacgagtcgattattcggg
acgttctgtcattgttgttggcccctcactttcattacatcgctgtggat
tgcctcgcgaaatagcaatagagcttttccagacatttgtaattcgcggt
ctaattagacaacatcttgctccgaacataggagttgctaagagtaaaat
tcgggaaaaagggccgattgtatgggaaatactgcaagaagttatgcggg
gacatcctgtattgctgaatagagcgcctactctgcatagattaggtata
caggcattccaacctattttagtggaaggacgcgctatttgtttacatcc
attagtttgtaagggattcaatgcagactttgatggggatcaaatggcag
ttcatgtacctttatctttagaggcgcaagcggaggctcgtttacttatg
ttttctcatatgaatctcttgtctccagctattggggatcccatttccgt
accgactcaagatatgcttattgggctctatgtattaacgagtgggaatc
gtcgaggtatttgtgcgaataggtataatccatggaatcgaaaaagctat
caaaatgaaagaattgacgataataactataagtctacaagggagccttt
tttttgtaattcctatgatgcgattggagcttataggcagaaaagaatca
atttagatagtcctttgtggctccggtggcgactagagcaatgcgttatt
gcttcaagagaagctcccatcgaagttcactatgaatctttgggtaccta
tcatgagatttatggacattatctaatagtaagaagtttaaaaaaaaaaa
ttctttgtatatacattcgaaccactgttggtcatatttctctttaccga
gaaatcgaagaagctatacaagggttttttcgggcctactcatatgatac
ccaatcatatggtatctaa
back to top

gene from alignment at NC_023215:21548..24366-

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>NC_023215.1-rpoC1 ID=NC_023215.1-rpoC1|Name=rpoC1|organism=Gossypium herbaceum|type=gene|length=2819bp|location=Sequence derived from alignment at NC_023215:21548..24366- (Gossypium herbaceum)
ATGATCGACCGATATAAACATCAACAACTCCGAATTGGATCAGTTTCTCC CCAACAAATAAGTGCTTGGGCCAAGAAAATCCTACCTAATGGAGAAACCG TTGGAGAGGTGACAAAACCCTATACTTTTCATTACAAAACCAATAAACCG GAAAAGGATGGATTATTTTGTGAAAGAATTTTTGGACCTATAAAAAGTGG AATTTGCGCTTGTGGAAATTATCGAGTAATTGGAAATCAAAAGGAGGGCC CTAAATTTTGTGAACAATGCGGAGTTGAATTTGTTGATTCTCGGATACGA AGATATCAAATGGGATACATAAGGCTGGCATGTCCAGTAACTCATGTATG GTATTTGAAACGCCTTCCTAGTTATATCGCCAATCTTTTAGACAAACCTC TTAAAGAATTAGAGGGTCTAGTATACTGCGATGTGTGATTTGATCGAAAT TATTATTTTACAGATTAGGAATGAGAAACTGTCATCCCATTCAATCGAAT TGGGATGCCCTGGATCTGACATGTCTCTTGGGAAGAGTAACATGAAGCTC AGAATTATGGGCGTATTCAATACTCCCAAATAAAAAGGGAATTGGTCTAT GGTCGAGTCAGTAAAAATAAATAACTAGGAATTTTGAGTTGTACCTCGTG AAAAAAAGACTTCTTTTTTTTGTGGAATTAACCGTTCTCATTTCTTTTAG TTCTTTTAGAAAGAAATGAAATTATGTTCAAGGAAACAAATATGTCATGG TTGCAGGAGTCTATACATCGCATATAGGCTTAGGCTTTAAGTTAAGGGCA TCGTGGTATAATCGTCGAGGTACCGCAGGACCTAAGAGATCGAATGGAAG GGTACATAGACAAGTAAATCCCTTATGACACTCCTTTAATTTTAGAGGAT TCAGCATTCGAGGGGAAGTAGACTACTCAAGAATTTCACATTTCATTTAT GTCCTAATTTTGAATTGAATAAAGAATTAAGAAAATCTAAATCAATAAAT CAATAAAAGAAGAATCAATCAATGAAATGTTTCTTGGAACTTGAGTAAAG AGTAGACCTTTTTTGGGGGTTCTAGAATTTGAAAGCGAGAACTCCTTTAC TTTATCTTTATTTGGTGTAACTACTTGAGCCGGATGAGAGGAAACTCTCA TGTCCGATTTTGAGGGGGGGATCCCGCAGGGCCCTATCCTAATTTTTCTT TTGCTAGGCCCATCGCTAAAAAACCTACTTTCTTACGATTACGAGGTTCA TTCGAATATGAAATTCAATCCTGGAAATACAGTATCCCACTTTTTTTTAC TACCCAAGGTTTCGATACATTTCGAAGTCGCGAAATTTCTACCGGAGCAG GTGCTATTCGAGAACAATTAGCCGATCTAGATTTGCGAATTCTTATCGAT TATTCGGTGGTAGAATGGAAAGAATTAGGAGAAGAAGGCCTCACGGGTAA TGAATGGGAAGATCGAAAAATTGGAAGAAGAAAGGATTTTTTGGTTAGAC GCATGGAATTGGCTAAGCATTTTATTCGAACAAATATAGAACCAGAATGG ATGGTTTTATGTCTATTACCGGTTCTTCCTCCCGAGTTGAGACCGATCAT TCAGATAGATGGGGGTAAACTAATGAGTTCGGATATTAATGAACTCTATA GAAGAGTTATCTATCGAAATAATACTCTTACCGATCTATTAACAACAAGT AGATCTACGCCAGGGGAATTAGTAATGTGTCAGGAAAAATTAGTACAAGA AGCCGTGGATACACTTCTTGATAATGGAATCCGCGGACAACCAATGAGGG ACGGTCATAATAAGGTTTACAAGTCGTTTTCAGATGTAATTGAAGGCAAA GAGGGAAGATTTCGCGAGACTTTGCTTGGCAAACGAGTCGATTATTCGGG ACGTTCTGTCATTGTTGTTGGCCCCTCACTTTCATTACATCGCTGTGGAT TGCCTCGCGAAATAGCAATAGAGCTTTTCCAGACATTTGTAATTCGCGGT CTAATTAGACAACATCTTGCTCCGAACATAGGAGTTGCTAAGAGTAAAAT TCGGGAAAAAGGGCCGATTGTATGGGAAATACTGCAAGAAGTTATGCGGG GACATCCTGTATTGCTGAATAGAGCGCCTACTCTGCATAGATTAGGTATA CAGGCATTCCAACCTATTTTAGTGGAAGGACGCGCTATTTGTTTACATCC ATTAGTTTGTAAGGGATTCAATGCAGACTTTGATGGGGATCAAATGGCAG TTCATGTACCTTTATCTTTAGAGGCGCAAGCGGAGGCTCGTTTACTTATG TTTTCTCATATGAATCTCTTGTCTCCAGCTATTGGGGATCCCATTTCCGT ACCGACTCAAGATATGCTTATTGGGCTCTATGTATTAACGAGTGGGAATC GTCGAGGTATTTGTGCGAATAGGTATAATCCATGGAATCGAAAAAGCTAT CAAAATGAAAGAATTGACGATAATAACTATAAGTCTACAAGGGAGCCTTT TTTTTGTAATTCCTATGATGCGATTGGAGCTTATAGGCAGAAAAGAATCA ATTTAGATAGTCCTTTGTGGCTCCGGTGGCGACTAGAGCAATGCGTTATT GCTTCAAGAGAAGCTCCCATCGAAGTTCACTATGAATCTTTGGGTACCTA TCATGAGATTTATGGACATTATCTAATAGTAAGAAGTTTAAAAAAAAAAA TTCTTTGTATATACATTCGAACCACTGTTGGTCATATTTCTCTTTACCGA GAAATCGAAGAAGCTATACAAGGGTTTTTTCGGGCCTACTCATATGATAC CCAATCATATGGTATCTAA
back to top