rpoC2, NC_023215.1-rpoC2 (gene) Gossypium herbaceum

Overview
NamerpoC2
Unique NameNC_023215.1-rpoC2
Typegene
OrganismGossypium herbaceum (Cotton (G. herbaceum))
Cross References
External references for this gene
DatabaseAccession
GeneID18126898
nuccoreNC_023215.1
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
rpoC2rpoC2Gossypium herbaceumgene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
rpoC2NC_023215.1-rpoC2.m12Gossypium herbaceummRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2019-03-14
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
NC_023215regionNC_023215:17199..21380 -
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>NC_023215.1-rpoC2 ID=NC_023215.1-rpoC2|Name=rpoC2|organism=Gossypium herbaceum|type=gene|length=4182bp
atggcagaacgggccaatctggtatttcacaataaagtgatagatggaac
tgccattaaacggcttattagcagattaatagatcacttcggaatggcat
atacatcacacatcctggatcaagtaaaagctctgggtttccagcaagcc
actgctacatccatttcattaggaattgatgatcttttaacgataccttc
taagggatggctagtccaagatgctgaacaacaaagtttgattttggaaa
aacaccatcattttgggaatgtacacgcggtagaaaaattacgccaatca
attgagatatggtatgctacaagtgaatatttgcgacaagaaatgaatcc
taattttaggatgactgacccgtttaacccagtccatataatgtcttttt
caggagctagaggaaatgcatctcaagtgcaccaattagtaggtatgaga
ggattaatgtcggatccccaaggacaaatgatcgatttacccattcaaag
caatttacgcgaaggactgtctttaacagaatatatcatttcttgctacg
gagcccgaaaaggggttgtggataccgccgtacgaacatcagatgctgga
tatcttacgcgcagacttgttgaagtagttcaacacattgttgtacgtag
aacagattgtggcaccacccgagggatttctgtgagtcctcaaaagagga
cgcttccagaaagaatttttatccaaacattaattggtcgtgtattagcg
gacgatatatatatgggtccgcggtgcattgccattcgaaatcaagatat
tgggcttgggcttgtcgatcgattcagagcctttcgaacacaaccaatat
ctattcgaactccctttacttgtaggagtacatcttggatttgtcgatta
tgttatggtcggagccccactcatggtgacctggttgaattgggagaagc
tgtaggtattattgcggggcaatccattggagaaccgggaacgcaactaa
cattaagaacttttcataccggcggagtatttacagggggtactgcagaa
catgtacgagccccttttaatggaaaaatcaaattcaatgaggatttggt
tcatcctacacgcacacgtcacgggcatcctgcttttttatgttatcagg
acttgtatgtaattattgagagcgaagatattatacataaggtgactatt
ccaccaaaaagttttcttttagttcaaaacgatcaatatgtagaatcaga
acaagtgattgctgagattcgcgcgggaacatacactttaaatttgaaag
agagggttcgaaaacatatttattctgactcagagggggaaatgcactgg
agtaccgatgtgtaccattcgcccgaatttacatatagtaatgtccatct
cttaccaaaaacaagccatttgtggatattatcagggggttcgtacaaat
tcagtgtagttcctttttcgctccacaaagatcaagatcaaataaacatt
cattatctttctgccgaacgaagatatatttctagattctcagtgaataa
tgatcaagtgagacacaacttatttagttcggatttttcggataaaaaag
aagataggatttacgattattcagaattgaatcgaataataggtactggg
cattgtgatttcatatattctgctattctccacgagaatgctgatttatt
ggcaaagagacgaagaaatagatttattattccatttcaattgattcaag
accaagagaaagaactaatgctgcattcccattccggtatctcgatcgaa
atacccataaatggtattttccgtagaaaaagtattcttgctttttttga
cgatcctcgatacagaagaaagagttcaggaattactaaatatgggactc
taggggcgcattcaatcgtcaaaagggaggatgtgattgagtatcgagga
gtcaaaaaggttaagccaaaataccaaatgaaagtagatcgatttttttt
cattcccgaggaagtgcatattttatccgaatcttcttccataatggtac
ggaacaatagtatcattggagtagatacccaaatcactttaaatacaaga
agccaagtgggcggattggtccgagtggaaagaaaaaaaaaaaggattga
actgaaaattttttcgggtaatatctattttcccggagaaagagataaga
tatctcgacacagtggcatcttgataccaccaggaacgggcaaaacaaac
tctaaggaatcaaaaaaattgaaaaattggatctatgtccaacggatcac
acctaccaagaaaaagtattttgttttggttcgacctgtaaccccatatg
aaataccggacggtctaaatttagcaacactcttcccccaggatccattt
cgggaaaaagataatatgcaacttcgagctgtcaattatatcctttatgg
aaatggcaaaccgactcggagaatttctgacacaagtattcaactagttc
ggacttgtttagtgttgagttgggaccaagacaacaaaagttctttcgcc
gaagaggtctgtgcttcctttgttgaagtaaggacaaatggtctgattcg
agatttcctaagaatcgacttagtgaaatctcatattttttatatcagaa
aaagaaatgatccgtcaggttcagaattgatttctgataataggtcagat
cgtaccaataaaaatccgttttattccatttattccaacgcaaggattca
acaatcgtttagccaaaatcacggaactattcatacgctcttgaacagaa
ataaggaatcccaatctttgataattttgtcatcatctaattgttttcgc
atgggcccattcaacgatgtaaaatatcacaatgtgataaaacaatcaat
taaaaaagatcctctaattccaattaagaatttattgggtcctttaggaa
cagcccccaaaattgcgaatttttattcatcattttaccctttaataact
cataatcagacctcggtagcgaaatatttggagcttgacaatttaaaaca
ggcttttcaagtacttaactattatttaatagctgaaaatgggagaattt
ataatttcgatccatgccgtaacatctttttgaatgcagtcaatttgaat
tggtattttccccatcatcattatcatcataattattgtgaagaaacgtc
cacaataattagtcttgggcagtttatttgtgaaaatgtatgtatagcca
aaagcggaccacgcctaaaatcgggtcaagtttttattgttcaagctgat
tctatagtaataagatcggctaagccttatttggcgactccgggagcaac
tgtccatgggcattatggagaaatcctttacgaaggagatacgttagtta
catttatatatgaaaaatcgagatctggtgatataacgcagggtcttcca
aaagtggaacaagtgttagaagtgcgttcgattgattcaatatcgatgaa
cctagaaaagagaattgagggttggaacgaatgtataacaagaattcttg
gaattccttggggattcgtgattggtgctgagctaactatagtgcaaagt
cgtctctctttggttaataagatccaaaaggtttatcgatctcagggggt
acagatccataataggcatatagaaattattgtacgtcaaataacatcaa
aagtattggtttcagaagatggaatgtctaatgtttttttacccggggaa
ctgattggattattgcgagcggaacgaacggggcgtgctttagaagaagc
gatttgttatcgagccgttttattgggaataacgagagcatctctgaaca
ctcaaagttttatatctgaagcaagttttcaagaaactgctcgagtttta
gcaaaagctgctctccggggtcgtatcgattggttgaaaggcctgaaaga
aaacgttgtgcttgggggtatgatacccgccggtaccggattcaaaggat
tagtgcaccggtcacggcaacataacaacattcttttggaaacaaaaaaa
aagaatttcttcgggggagaaatgagagatattttcttccaccaccgaga
attatttgactcttgcatttcaaacaatttacatgatacatcaggccgct
cttttataggtatagaatttaatgattcttaa
back to top

gene from alignment at NC_023215:17199..21380-

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>NC_023215.1-rpoC2 ID=NC_023215.1-rpoC2|Name=rpoC2|organism=Gossypium herbaceum|type=gene|length=4182bp|location=Sequence derived from alignment at NC_023215:17199..21380- (Gossypium herbaceum)
ATGGCAGAACGGGCCAATCTGGTATTTCACAATAAAGTGATAGATGGAAC TGCCATTAAACGGCTTATTAGCAGATTAATAGATCACTTCGGAATGGCAT ATACATCACACATCCTGGATCAAGTAAAAGCTCTGGGTTTCCAGCAAGCC ACTGCTACATCCATTTCATTAGGAATTGATGATCTTTTAACGATACCTTC TAAGGGATGGCTAGTCCAAGATGCTGAACAACAAAGTTTGATTTTGGAAA AACACCATCATTTTGGGAATGTACACGCGGTAGAAAAATTACGCCAATCA ATTGAGATATGGTATGCTACAAGTGAATATTTGCGACAAGAAATGAATCC TAATTTTAGGATGACTGACCCGTTTAACCCAGTCCATATAATGTCTTTTT CAGGAGCTAGAGGAAATGCATCTCAAGTGCACCAATTAGTAGGTATGAGA GGATTAATGTCGGATCCCCAAGGACAAATGATCGATTTACCCATTCAAAG CAATTTACGCGAAGGACTGTCTTTAACAGAATATATCATTTCTTGCTACG GAGCCCGAAAAGGGGTTGTGGATACCGCCGTACGAACATCAGATGCTGGA TATCTTACGCGCAGACTTGTTGAAGTAGTTCAACACATTGTTGTACGTAG AACAGATTGTGGCACCACCCGAGGGATTTCTGTGAGTCCTCAAAAGAGGA CGCTTCCAGAAAGAATTTTTATCCAAACATTAATTGGTCGTGTATTAGCG GACGATATATATATGGGTCCGCGGTGCATTGCCATTCGAAATCAAGATAT TGGGCTTGGGCTTGTCGATCGATTCAGAGCCTTTCGAACACAACCAATAT CTATTCGAACTCCCTTTACTTGTAGGAGTACATCTTGGATTTGTCGATTA TGTTATGGTCGGAGCCCCACTCATGGTGACCTGGTTGAATTGGGAGAAGC TGTAGGTATTATTGCGGGGCAATCCATTGGAGAACCGGGAACGCAACTAA CATTAAGAACTTTTCATACCGGCGGAGTATTTACAGGGGGTACTGCAGAA CATGTACGAGCCCCTTTTAATGGAAAAATCAAATTCAATGAGGATTTGGT TCATCCTACACGCACACGTCACGGGCATCCTGCTTTTTTATGTTATCAGG ACTTGTATGTAATTATTGAGAGCGAAGATATTATACATAAGGTGACTATT CCACCAAAAAGTTTTCTTTTAGTTCAAAACGATCAATATGTAGAATCAGA ACAAGTGATTGCTGAGATTCGCGCGGGAACATACACTTTAAATTTGAAAG AGAGGGTTCGAAAACATATTTATTCTGACTCAGAGGGGGAAATGCACTGG AGTACCGATGTGTACCATTCGCCCGAATTTACATATAGTAATGTCCATCT CTTACCAAAAACAAGCCATTTGTGGATATTATCAGGGGGTTCGTACAAAT TCAGTGTAGTTCCTTTTTCGCTCCACAAAGATCAAGATCAAATAAACATT CATTATCTTTCTGCCGAACGAAGATATATTTCTAGATTCTCAGTGAATAA TGATCAAGTGAGACACAACTTATTTAGTTCGGATTTTTCGGATAAAAAAG AAGATAGGATTTACGATTATTCAGAATTGAATCGAATAATAGGTACTGGG CATTGTGATTTCATATATTCTGCTATTCTCCACGAGAATGCTGATTTATT GGCAAAGAGACGAAGAAATAGATTTATTATTCCATTTCAATTGATTCAAG ACCAAGAGAAAGAACTAATGCTGCATTCCCATTCCGGTATCTCGATCGAA ATACCCATAAATGGTATTTTCCGTAGAAAAAGTATTCTTGCTTTTTTTGA CGATCCTCGATACAGAAGAAAGAGTTCAGGAATTACTAAATATGGGACTC TAGGGGCGCATTCAATCGTCAAAAGGGAGGATGTGATTGAGTATCGAGGA GTCAAAAAGGTTAAGCCAAAATACCAAATGAAAGTAGATCGATTTTTTTT CATTCCCGAGGAAGTGCATATTTTATCCGAATCTTCTTCCATAATGGTAC GGAACAATAGTATCATTGGAGTAGATACCCAAATCACTTTAAATACAAGA AGCCAAGTGGGCGGATTGGTCCGAGTGGAAAGAAAAAAAAAAAGGATTGA ACTGAAAATTTTTTCGGGTAATATCTATTTTCCCGGAGAAAGAGATAAGA TATCTCGACACAGTGGCATCTTGATACCACCAGGAACGGGCAAAACAAAC TCTAAGGAATCAAAAAAATTGAAAAATTGGATCTATGTCCAACGGATCAC ACCTACCAAGAAAAAGTATTTTGTTTTGGTTCGACCTGTAACCCCATATG AAATACCGGACGGTCTAAATTTAGCAACACTCTTCCCCCAGGATCCATTT CGGGAAAAAGATAATATGCAACTTCGAGCTGTCAATTATATCCTTTATGG AAATGGCAAACCGACTCGGAGAATTTCTGACACAAGTATTCAACTAGTTC GGACTTGTTTAGTGTTGAGTTGGGACCAAGACAACAAAAGTTCTTTCGCC GAAGAGGTCTGTGCTTCCTTTGTTGAAGTAAGGACAAATGGTCTGATTCG AGATTTCCTAAGAATCGACTTAGTGAAATCTCATATTTTTTATATCAGAA AAAGAAATGATCCGTCAGGTTCAGAATTGATTTCTGATAATAGGTCAGAT CGTACCAATAAAAATCCGTTTTATTCCATTTATTCCAACGCAAGGATTCA ACAATCGTTTAGCCAAAATCACGGAACTATTCATACGCTCTTGAACAGAA ATAAGGAATCCCAATCTTTGATAATTTTGTCATCATCTAATTGTTTTCGC ATGGGCCCATTCAACGATGTAAAATATCACAATGTGATAAAACAATCAAT TAAAAAAGATCCTCTAATTCCAATTAAGAATTTATTGGGTCCTTTAGGAA CAGCCCCCAAAATTGCGAATTTTTATTCATCATTTTACCCTTTAATAACT CATAATCAGACCTCGGTAGCGAAATATTTGGAGCTTGACAATTTAAAACA GGCTTTTCAAGTACTTAACTATTATTTAATAGCTGAAAATGGGAGAATTT ATAATTTCGATCCATGCCGTAACATCTTTTTGAATGCAGTCAATTTGAAT TGGTATTTTCCCCATCATCATTATCATCATAATTATTGTGAAGAAACGTC CACAATAATTAGTCTTGGGCAGTTTATTTGTGAAAATGTATGTATAGCCA AAAGCGGACCACGCCTAAAATCGGGTCAAGTTTTTATTGTTCAAGCTGAT TCTATAGTAATAAGATCGGCTAAGCCTTATTTGGCGACTCCGGGAGCAAC TGTCCATGGGCATTATGGAGAAATCCTTTACGAAGGAGATACGTTAGTTA CATTTATATATGAAAAATCGAGATCTGGTGATATAACGCAGGGTCTTCCA AAAGTGGAACAAGTGTTAGAAGTGCGTTCGATTGATTCAATATCGATGAA CCTAGAAAAGAGAATTGAGGGTTGGAACGAATGTATAACAAGAATTCTTG GAATTCCTTGGGGATTCGTGATTGGTGCTGAGCTAACTATAGTGCAAAGT CGTCTCTCTTTGGTTAATAAGATCCAAAAGGTTTATCGATCTCAGGGGGT ACAGATCCATAATAGGCATATAGAAATTATTGTACGTCAAATAACATCAA AAGTATTGGTTTCAGAAGATGGAATGTCTAATGTTTTTTTACCCGGGGAA CTGATTGGATTATTGCGAGCGGAACGAACGGGGCGTGCTTTAGAAGAAGC GATTTGTTATCGAGCCGTTTTATTGGGAATAACGAGAGCATCTCTGAACA CTCAAAGTTTTATATCTGAAGCAAGTTTTCAAGAAACTGCTCGAGTTTTA GCAAAAGCTGCTCTCCGGGGTCGTATCGATTGGTTGAAAGGCCTGAAAGA AAACGTTGTGCTTGGGGGTATGATACCCGCCGGTACCGGATTCAAAGGAT TAGTGCACCGGTCACGGCAACATAACAACATTCTTTTGGAAACAAAAAAA AAGAATTTCTTCGGGGGAGAAATGAGAGATATTTTCTTCCACCACCGAGA ATTATTTGACTCTTGCATTTCAAACAATTTACATGATACATCAGGCCGCT CTTTTATAGGTATAGAATTTAATGATTCTTAA
back to top