atpI, HQ325742.1-atpI (gene) Gossypium herbaceum

Overview
NameatpI
Unique NameHQ325742.1-atpI
Typegene
OrganismGossypium herbaceum (Cotton (G. herbaceum))
Cross References
External references for this gene
DatabaseAccession
nuccoreHQ325742.1
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
atpIatpIGossypium herbaceumgene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
atpIHQ325742.1-atpI.m10Gossypium herbaceummRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2019-03-14
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
HQ325742regionHQ325742:15365..16099 -
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>HQ325742.1-atpI ID=HQ325742.1-atpI|Name=atpI|organism=Gossypium herbaceum|type=gene|length=735bp
atgaatggtatatcaaacgcactaaacgggttatacgatatctctggtgt
ggaagtaggccaacatttctattggcaaatagcaggtttccaagtccatg
cccaagtacttattacctcttgggttgtaattgctatcttattaggttcc
gccgttatcgctgttcggaatccacaaaccattccaaccgccggtcaaaa
tttcttcgaatatgttcttgaattcattcgagacgtaagcaaaactcaga
ttggagaagaatatggtccatgggttccctttattggaactatgtttcta
tttatttttgtttctaactggtcgggtgctctgttaccttggaaaatcat
acaattacctcatggagagttagccgcacccacgaatgatataaatacta
ctgttgctttagctttactcacgtcagtagcatatttctatgcgggtctt
tcaaaaaaaggattggggtatttcagtaaatacattcaacccactccaat
tcttttacctattaacattttagaggatttcacaaaacccttatcactta
gttttcgacttttcgggaatatattagctgatgaattagtagttgttgtt
cttgtttctttagtaccttcagtcgtccctatacctgtcatgttccttgg
attatttacaagtgggattcaagctcttatttttgcaactttagctgcgg
cttatataggcgaatccatggagggtcatcattga
back to top

gene from alignment at HQ325742:15365..16099-

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>HQ325742.1-atpI ID=HQ325742.1-atpI|Name=atpI|organism=Gossypium herbaceum|type=gene|length=735bp|location=Sequence derived from alignment at HQ325742:15365..16099- (Gossypium herbaceum)
ATGAATGGTATATCAAACGCACTAAACGGGTTATACGATATCTCTGGTGT GGAAGTAGGCCAACATTTCTATTGGCAAATAGCAGGTTTCCAAGTCCATG CCCAAGTACTTATTACCTCTTGGGTTGTAATTGCTATCTTATTAGGTTCC GCCGTTATCGCTGTTCGGAATCCACAAACCATTCCAACCGCCGGTCAAAA TTTCTTCGAATATGTTCTTGAATTCATTCGAGACGTAAGCAAAACTCAGA TTGGAGAAGAATATGGTCCATGGGTTCCCTTTATTGGAACTATGTTTCTA TTTATTTTTGTTTCTAACTGGTCGGGTGCTCTGTTACCTTGGAAAATCAT ACAATTACCTCATGGAGAGTTAGCCGCACCCACGAATGATATAAATACTA CTGTTGCTTTAGCTTTACTCACGTCAGTAGCATATTTCTATGCGGGTCTT TCAAAAAAAGGATTGGGGTATTTCAGTAAATACATTCAACCCACTCCAAT TCTTTTACCTATTAACATTTTAGAGGATTTCACAAAACCCTTATCACTTA GTTTTCGACTTTTCGGGAATATATTAGCTGATGAATTAGTAGTTGTTGTT CTTGTTTCTTTAGTACCTTCAGTCGTCCCTATACCTGTCATGTTCCTTGG ATTATTTACAAGTGGGATTCAAGCTCTTATTTTTGCAACTTTAGCTGCGG CTTATATAGGCGAATCCATGGAGGGTCATCATTGA
back to top