trnR-UCU, HQ325742.1-trnR-UCU (gene) Gossypium herbaceum

Overview
NametrnR-UCU
Unique NameHQ325742.1-trnR-UCU
Typegene
OrganismGossypium herbaceum (Cotton (G. herbaceum))
Cross References
External references for this gene
DatabaseAccession
nuccoreHQ325742.1
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
trnR-UCUtrnR-UCUGossypium herbaceumgene


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2019-03-14
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
HQ325742regionHQ325742:10180..10251 +
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>HQ325742.1-trnR-UCU ID=HQ325742.1-trnR-UCU|Name=trnR-UCU|organism=Gossypium herbaceum|type=gene|length=72bp
gcgtccattgtctaatggataggacagaggtcttctaaacctttggtata
ggttcaaatcctattggacgca
back to top