trnH-GUG, HQ325742.1-trnH-GUG (gene) Gossypium herbaceum

Overview
NametrnH-GUG
Unique NameHQ325742.1-trnH-GUG
Typegene
OrganismGossypium herbaceum (Cotton (G. herbaceum))
Cross References
External references for this gene
DatabaseAccession
nuccoreHQ325742.1
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
trnH-GUGtrnH-GUGGossypium herbaceumgene


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2019-03-14
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
HQ325742regionHQ325742:3..77 -
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>HQ325742.1-trnH-GUG ID=HQ325742.1-trnH-GUG|Name=trnH-GUG|organism=Gossypium herbaceum|type=gene|length=75bp
ggcggatgtagccaagtggatcaaggcagtggattgtgaatccaccatgc
gcgggttcaattcccgtcgttcgcc
back to top