trnC-GCA, JF317353.1-trnC-GCA (gene) Gossypium herbaceum

Overview
NametrnC-GCA
Unique NameJF317353.1-trnC-GCA
Typegene
OrganismGossypium herbaceum (Cotton (G. herbaceum))
Cross References
External references for this gene
DatabaseAccession
nuccoreJF317353.1
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
trnC-GCAtrnC-GCAGossypium herbaceumgene


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2019-03-14
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
JF317353regionJF317353:28819..28899 +
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>JF317353.1-trnC-GCA ID=JF317353.1-trnC-GCA|Name=trnC-GCA|organism=Gossypium herbaceum|type=gene|length=81bp
ggcgacatggccgagcggtaaggcgggggactgcaaatcccttattcccc
agttcaaatccgggtgtcgcctgatcaacaa
back to top