psbK, JF317353.1-psbK (gene) Gossypium herbaceum

Unique NameJF317353.1-psbK
OrganismGossypium herbaceum (Cotton (G. herbaceum))
Cross References
External references for this gene

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
psbKpsbKGossypium herbaceumgene

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
psbKJF317353.1-psbK.m5Gossypium herbaceummRNA

This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2019-03-14
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
JF317353regionJF317353:7314..7499 +
Property NameValue
The following sequences are available for this feature:

gene sequence

>JF317353.1-psbK ID=JF317353.1-psbK|Name=psbK|organism=Gossypium herbaceum|type=gene|length=186bp
back to top

gene from alignment at JF317353:7314..7499+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>JF317353.1-psbK ID=JF317353.1-psbK|Name=psbK|organism=Gossypium herbaceum|type=gene|length=186bp|location=Sequence derived from alignment at JF317353:7314..7499+ (Gossypium herbaceum)
atgcttaatatctttaatttgatctgtatctgttttaattctgccctttt ttcgagtagttttttattcgccaaattgcccgaggcctatgcttttttga atccaatcgtagattttatgccagtaatacctgttctctttttgctctta gcctttgtttggcaagctgctgtaagttttcgatga
back to top